ID: 1151433636

View in Genome Browser
Species Human (GRCh38)
Location 17:74081146-74081168
Sequence GCCCCACAGCACCTCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151433629_1151433636 -8 Left 1151433629 17:74081131-74081153 CCCCTGGTCGGACTGGCCCCACA No data
Right 1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG No data
1151433631_1151433636 -10 Left 1151433631 17:74081133-74081155 CCTGGTCGGACTGGCCCCACAGC No data
Right 1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG No data
1151433630_1151433636 -9 Left 1151433630 17:74081132-74081154 CCCTGGTCGGACTGGCCCCACAG No data
Right 1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151433636 Original CRISPR GCCCCACAGCACCTCGGGGT GGG Intergenic
No off target data available for this crispr