ID: 1151433984

View in Genome Browser
Species Human (GRCh38)
Location 17:74082862-74082884
Sequence CTCTTCACAAGTCCCCGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151433984_1151433991 3 Left 1151433984 17:74082862-74082884 CCTTGCCGGGGACTTGTGAAGAG No data
Right 1151433991 17:74082888-74082910 GGTGAGGAAGAAGACCCAGGAGG No data
1151433984_1151433990 0 Left 1151433984 17:74082862-74082884 CCTTGCCGGGGACTTGTGAAGAG No data
Right 1151433990 17:74082885-74082907 GAGGGTGAGGAAGAAGACCCAGG No data
1151433984_1151433994 17 Left 1151433984 17:74082862-74082884 CCTTGCCGGGGACTTGTGAAGAG No data
Right 1151433994 17:74082902-74082924 CCCAGGAGGAGAGGCACCACAGG No data
1151433984_1151433992 8 Left 1151433984 17:74082862-74082884 CCTTGCCGGGGACTTGTGAAGAG No data
Right 1151433992 17:74082893-74082915 GGAAGAAGACCCAGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151433984 Original CRISPR CTCTTCACAAGTCCCCGGCA AGG (reversed) Intergenic
No off target data available for this crispr