ID: 1151434123

View in Genome Browser
Species Human (GRCh38)
Location 17:74083576-74083598
Sequence CCCGGGATTCAGAGGTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151434114_1151434123 24 Left 1151434114 17:74083529-74083551 CCACCTGTTGCAGGTAAAGGGTA No data
Right 1151434123 17:74083576-74083598 CCCGGGATTCAGAGGTCACTTGG No data
1151434111_1151434123 27 Left 1151434111 17:74083526-74083548 CCACCACCTGTTGCAGGTAAAGG No data
Right 1151434123 17:74083576-74083598 CCCGGGATTCAGAGGTCACTTGG No data
1151434115_1151434123 21 Left 1151434115 17:74083532-74083554 CCTGTTGCAGGTAAAGGGTATAA No data
Right 1151434123 17:74083576-74083598 CCCGGGATTCAGAGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151434123 Original CRISPR CCCGGGATTCAGAGGTCACT TGG Intergenic