ID: 1151434777 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:74088295-74088317 |
Sequence | CAGGCAGGCGGAGCTGCCCT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151434777_1151434787 | 20 | Left | 1151434777 | 17:74088295-74088317 | CCAAGGGCAGCTCCGCCTGCCTG | No data | ||
Right | 1151434787 | 17:74088338-74088360 | CCTGCACACACATCACACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151434777 | Original CRISPR | CAGGCAGGCGGAGCTGCCCT TGG (reversed) | Intergenic | ||