ID: 1151434777

View in Genome Browser
Species Human (GRCh38)
Location 17:74088295-74088317
Sequence CAGGCAGGCGGAGCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151434777_1151434787 20 Left 1151434777 17:74088295-74088317 CCAAGGGCAGCTCCGCCTGCCTG No data
Right 1151434787 17:74088338-74088360 CCTGCACACACATCACACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151434777 Original CRISPR CAGGCAGGCGGAGCTGCCCT TGG (reversed) Intergenic