ID: 1151436248

View in Genome Browser
Species Human (GRCh38)
Location 17:74099620-74099642
Sequence TGATCTCTGCAGGAGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151436248_1151436255 -6 Left 1151436248 17:74099620-74099642 CCATTTCCCTCCTGCAGAGATCA 0: 1
1: 0
2: 0
3: 32
4: 381
Right 1151436255 17:74099637-74099659 AGATCACAGCTGGGAGATGGTGG 0: 1
1: 0
2: 2
3: 48
4: 422
1151436248_1151436260 30 Left 1151436248 17:74099620-74099642 CCATTTCCCTCCTGCAGAGATCA 0: 1
1: 0
2: 0
3: 32
4: 381
Right 1151436260 17:74099673-74099695 ATCAGAGGAGAGCGATCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1151436248_1151436254 -9 Left 1151436248 17:74099620-74099642 CCATTTCCCTCCTGCAGAGATCA 0: 1
1: 0
2: 0
3: 32
4: 381
Right 1151436254 17:74099634-74099656 CAGAGATCACAGCTGGGAGATGG 0: 1
1: 0
2: 3
3: 39
4: 429
1151436248_1151436259 29 Left 1151436248 17:74099620-74099642 CCATTTCCCTCCTGCAGAGATCA 0: 1
1: 0
2: 0
3: 32
4: 381
Right 1151436259 17:74099672-74099694 AATCAGAGGAGAGCGATCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 81
1151436248_1151436256 15 Left 1151436248 17:74099620-74099642 CCATTTCCCTCCTGCAGAGATCA 0: 1
1: 0
2: 0
3: 32
4: 381
Right 1151436256 17:74099658-74099680 GGACTCCCACGTGAAATCAGAGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151436248 Original CRISPR TGATCTCTGCAGGAGGGAAA TGG (reversed) Intergenic
900721968 1:4182547-4182569 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
901106104 1:6757918-6757940 TAAACTATGCAAGAGGGAAAAGG - Intergenic
901535753 1:9882107-9882129 TGAGCTCTGCAGGAAGGCAGGGG + Intronic
904401297 1:30258269-30258291 TGATCTCTGGAGAAGGGGGATGG - Intergenic
904607444 1:31705436-31705458 TGAGCTCAGCAGGCGGGAAGCGG + Intergenic
904771100 1:32881882-32881904 TGAGCTCTGCAAGATGGAGATGG - Intergenic
905533299 1:38699397-38699419 GGATCCCTGGAGGAGGGAACTGG - Intergenic
905743376 1:40391740-40391762 TGCCCACTGCGGGAGGGAAAGGG - Intronic
905994668 1:42371149-42371171 TTATGTCTGCAGAAAGGAAAAGG + Intergenic
906836093 1:49084727-49084749 TGAATGCTGCAGGAGGGAAGAGG - Intronic
907248999 1:53125573-53125595 TGAACCCAGTAGGAGGGAAAAGG + Intronic
908487391 1:64608324-64608346 TGAGCTGTACAGGAGGAAAAGGG - Intronic
910162004 1:84283025-84283047 AGATCACTGCAGAAGGGAAAGGG - Intergenic
910690172 1:89957500-89957522 TCATTTTTGCAGGAGGAAAATGG - Intergenic
911707284 1:101027949-101027971 TGATCTAGGCAGGAGAGAATGGG - Intergenic
911759426 1:101599200-101599222 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
911819868 1:102404334-102404356 TGATCATGGCAGAAGGGAAAAGG + Intergenic
912209338 1:107541566-107541588 TAATCTGTGCATGTGGGAAAAGG - Intergenic
912841313 1:113041947-113041969 CCATCTCTGCTGGAGGGGAAAGG + Intergenic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
915490166 1:156246293-156246315 AGATCTCAGATGGAGGGAAAGGG - Intronic
916946105 1:169729300-169729322 TGAACTCTCCAGCAGGGGAATGG + Exonic
918331885 1:183469328-183469350 TTATATCTGTAGGGGGGAAAAGG + Intergenic
919150609 1:193692880-193692902 TGGTTTCTGAAAGAGGGAAATGG + Intergenic
920610644 1:207433640-207433662 TGCTTTCTGCAGGATGGTAAAGG - Intergenic
920677627 1:208049087-208049109 TGGTTTCTGCAGGAAGGAACAGG - Intronic
920679406 1:208060832-208060854 CAAAATCTGCAGGAGGGAAATGG + Exonic
920876835 1:209844214-209844236 TGACATTTGCAGGAGGTAAAAGG + Intronic
921520562 1:216150600-216150622 TGAGTTCTTCAGGAGGGTAAAGG - Intronic
922355864 1:224774524-224774546 TGGTGTCTGTAGGAAGGAAAAGG - Intergenic
922400645 1:225250724-225250746 TGGTTTCTGCAGGAAGGAATGGG + Intronic
923329712 1:232911347-232911369 TTATTTCTGCAGGAAGGAATGGG - Intergenic
923385252 1:233459789-233459811 TGGTTTCTGCAGGAAGGAACAGG - Intergenic
923434383 1:233954683-233954705 TAATCTCAGCAGGGGGGAAAAGG - Intronic
924634255 1:245769966-245769988 TGATCTCTGCTGGATTGAACTGG - Intronic
1062926665 10:1321241-1321263 TGCTCTCTGCAAGAGAGAAGAGG - Intronic
1062931139 10:1353467-1353489 TGAGTTCTTCAGGAGGGTAAAGG - Intronic
1062974902 10:1675845-1675867 TGATCCCTGCAGGAGGGCAGAGG + Intronic
1063599665 10:7468960-7468982 TGATCTCTACAAAAAGGAAAAGG + Intergenic
1065417817 10:25508193-25508215 AGATCTGTGGAGGAAGGAAAAGG + Intronic
1065610771 10:27468892-27468914 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1069888988 10:71641377-71641399 TGAGCTCTGCAGCAGGGGAGAGG - Intronic
1070338098 10:75472719-75472741 TGATCTCTGCAGTTTGGCAAGGG + Intronic
1071329480 10:84545611-84545633 TGTACTCCCCAGGAGGGAAAAGG - Intergenic
1071348247 10:84713923-84713945 TAATCACGGCAGAAGGGAAAGGG - Intergenic
1072125304 10:92440450-92440472 TGATCTGTGTAGGGGTGAAAAGG - Intergenic
1072565693 10:96615063-96615085 TGAACTCTGAAGGATGAAAAGGG + Intronic
1073673291 10:105616473-105616495 AAATGTATGCAGGAGGGAAAGGG - Intergenic
1073942850 10:108718075-108718097 TGATGTCTGCAGGACTGAATAGG + Intergenic
1074547471 10:114412459-114412481 TGATCTCTTCTGGAGGGTGAAGG - Intergenic
1074721159 10:116266413-116266435 TGGCCTTTGCAGGATGGAAAAGG - Intronic
1074883542 10:117677152-117677174 AGTTCTCTGCTGTAGGGAAAGGG + Intergenic
1075321686 10:121496243-121496265 TCAGCTCTCCAGGTGGGAAATGG - Intronic
1077599660 11:3565470-3565492 TAAGTTCTGCAGTAGGGAAAGGG - Intergenic
1079797856 11:24828906-24828928 AGATCTCTGCAGGTAGGAGAGGG + Intronic
1080421687 11:32116629-32116651 TGATCTCACCAGGAGGTAATTGG + Intergenic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1082866365 11:57903308-57903330 TAATCTCTTCAGGATGGGAAGGG + Intergenic
1082893787 11:58168243-58168265 TTAGCTCTGCAGGAGGACAAAGG - Intronic
1084354799 11:68630784-68630806 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1084480309 11:69416095-69416117 TGGGCTCTGCAGGAGGGCCAGGG - Intergenic
1084603749 11:70161144-70161166 TGCAATCTGCAGGGGGGAAAGGG - Exonic
1084638620 11:70410642-70410664 TCTTCTCTCCAGGAAGGAAAAGG - Intronic
1085904933 11:80749039-80749061 TGATCTCTCCCTAAGGGAAAGGG + Intergenic
1085945671 11:81269380-81269402 TCTTCTCTTCAAGAGGGAAATGG - Intergenic
1086005367 11:82029770-82029792 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1086377812 11:86218881-86218903 TTATTTCTGCAGCAGGGCAAGGG - Intergenic
1087197491 11:95315724-95315746 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1087936386 11:104038194-104038216 TGATCTCTGGACAAGGGAAATGG - Exonic
1088733719 11:112707787-112707809 TGACCTCAGGAGCAGGGAAATGG - Intergenic
1089398140 11:118149232-118149254 TGATCCCTGGATGTGGGAAAAGG - Intronic
1089922028 11:122218136-122218158 TGTTTTCTGCAGGAGAGAAATGG - Intergenic
1089953934 11:122553544-122553566 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1091801881 12:3329487-3329509 TGAGCTCTCCAGGAGGGCATAGG + Intergenic
1092580519 12:9835939-9835961 TGAGTTCTTCAGGAGGGTAAAGG + Intronic
1092973073 12:13717683-13717705 TGATCTCTGGGGGTGGGGAAGGG - Intronic
1093359066 12:18201615-18201637 TGAGTTCTTCAGGAGGGTAAAGG - Intronic
1093915552 12:24798511-24798533 TGACCACTGAAGTAGGGAAAAGG + Intergenic
1093951431 12:25167693-25167715 TGAGTTCTTCAGGAGGGTAAAGG - Intronic
1094675448 12:32615750-32615772 TGGTTTCTGCAGGAAGGAATGGG + Intronic
1095168152 12:38999303-38999325 TGTTAACTCCAGGAGGGAAAAGG + Intergenic
1095308374 12:40664176-40664198 TGATCCCTGGAGGAGGGATGTGG - Intergenic
1096081674 12:48837434-48837456 TGATCTCTGCATGTGAGAATTGG - Intronic
1096160368 12:49371685-49371707 TGATCATGGCAGGAGGCAAAGGG + Intronic
1098533669 12:71570448-71570470 TCATCTCTGCAGGCTGCAAAGGG - Intronic
1099362170 12:81717820-81717842 TGCTCTCAGGAGGAGGGGAATGG + Intronic
1100158245 12:91827199-91827221 AGGTCTCTGAAGGAGGGAGAAGG - Intergenic
1100282383 12:93130257-93130279 TGAGCTCTCAAGGAGGCAAATGG - Intergenic
1101546364 12:105717068-105717090 TGATCTCTCCAAAAGGAAAATGG - Intergenic
1102551401 12:113694718-113694740 TGACCCCTGCAGGAGGGGCATGG - Intergenic
1103538737 12:121651639-121651661 TGTTCTCTGCAGGGGAGAGAGGG + Exonic
1103896011 12:124273766-124273788 TGACCTCAGCAGGAGTGACAAGG + Intronic
1104970304 12:132527936-132527958 AGAGCTCTGCAGGAAGGAAGAGG - Exonic
1105845647 13:24291565-24291587 TGCTCCCAGCAGGAGGGAACAGG - Intronic
1108313502 13:49217866-49217888 TGATGTCTGGAGGAGGAGAAAGG + Intergenic
1109657833 13:65417490-65417512 TGGTTTCTGCATGAGGAAAAGGG + Intergenic
1110433897 13:75458192-75458214 GGATCTCTGCAGGATGGATGGGG + Intronic
1111143670 13:84154646-84154668 AGATCTCTGCAGTAGAGGAATGG + Intergenic
1111979527 13:95002349-95002371 TTATCTCTACAGGAGGCCAAGGG - Intergenic
1113060313 13:106315213-106315235 TGTTTTCAGCAGGAGAGAAAGGG - Intergenic
1113321335 13:109235329-109235351 GAATCACTGCAGGAGGTAAAAGG - Intergenic
1113442305 13:110338660-110338682 CCATCTCTGCAGCTGGGAAAAGG + Intronic
1116891063 14:50268870-50268892 TTCTCTCTGGTGGAGGGAAAGGG - Intronic
1118936712 14:70295470-70295492 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
1119982183 14:79094145-79094167 TGATCTCTGCCGGGGAGAAATGG + Intronic
1120031548 14:79646938-79646960 TCATCTTTGTAGGAGGCAAAGGG + Intronic
1120139136 14:80908179-80908201 TGATCTCTGTGGGTCGGAAATGG - Intronic
1122041497 14:98990854-98990876 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1122997734 14:105274614-105274636 TGATGGCATCAGGAGGGAAATGG + Intronic
1123758561 15:23415727-23415749 TGATCTCTGCTGGGGTGAGAGGG - Intergenic
1126529807 15:49700298-49700320 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
1127185733 15:56478528-56478550 TGATCTTTGGAAGAGGGAACTGG + Intergenic
1127333031 15:57957021-57957043 TGATCTGTGCACGGGGGAAGTGG + Intronic
1128355500 15:66923646-66923668 TGATCTCTGCAGGAGATCAGGGG + Intergenic
1128513301 15:68326791-68326813 TGATGCCTGCAGGAGGGGAGAGG + Exonic
1128727768 15:70000482-70000504 GGCTCTCAGCAGGAGGGAGAGGG - Intergenic
1129343350 15:74900626-74900648 TGGTCTCTGCAGATGGGGAAGGG + Exonic
1129539657 15:76339769-76339791 TGGGCTCTGAAGGAGGGGAAGGG + Intronic
1130350108 15:83084081-83084103 GGATGTGTGCAGGAGGGAATAGG - Intergenic
1130712106 15:86293473-86293495 TGTTCTCTGCAGCCAGGAAAGGG + Intronic
1130906544 15:88244630-88244652 TGATTTCTGCAGGGAGGGAAGGG - Intronic
1132455216 16:18437-18459 TGACCTCTGCAGAGGGGGAACGG + Intronic
1133239316 16:4405053-4405075 TGGGCTCTGCAAGAGGGACATGG - Intronic
1133428327 16:5712862-5712884 TGAACTCTGCAGCACAGAAATGG - Intergenic
1133766232 16:8839979-8840001 TGAGTTCTTCAGGAGGGTAAAGG + Intronic
1134230632 16:12426469-12426491 GGAGCCCTGCAGGAGGGTAATGG + Intronic
1134313634 16:13098512-13098534 TGTTCTCTGCAAGTGAGAAAGGG + Intronic
1134328632 16:13230022-13230044 TGATCTGATCAGGAGGGAGATGG - Intronic
1134457777 16:14407144-14407166 TGATCTCTGCTGGGGTGAGAGGG + Intergenic
1137771348 16:51017839-51017861 TGTTTTCTGCAGAAGGAAAAAGG - Intergenic
1138758504 16:59517003-59517025 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1140575029 16:76157844-76157866 TCAGCTCTGCAGCAGGGCAAAGG + Intergenic
1140728999 16:77839169-77839191 TGATGTCTGAAGGAGGGGGAGGG + Intronic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1142229348 16:88892480-88892502 TCATCACTGCAGGAGGGAAGCGG + Exonic
1142373381 16:89695075-89695097 TGATCTCTGCACGGGGGGCAGGG + Intronic
1144406129 17:14954426-14954448 TGATTTCTCCAGGAAGGAACAGG + Intergenic
1144463778 17:15480165-15480187 TGAGCTCTTAGGGAGGGAAAGGG - Intronic
1147558266 17:41493413-41493435 AGATCTCTGCAGAAGGCCAATGG + Intergenic
1147791961 17:43019641-43019663 GCCTCTGTGCAGGAGGGAAAGGG + Intronic
1148074851 17:44929301-44929323 TGATCTGAGAAGTAGGGAAATGG + Intronic
1148514534 17:48204146-48204168 TGATCTCGGCTGGAGTGCAATGG + Intronic
1148744679 17:49911698-49911720 TGAGCCCGGCAGGAGGGAAGTGG + Intergenic
1149513334 17:57260239-57260261 AGATCTCTGAAGGAGAGGAAGGG - Intronic
1150030442 17:61728822-61728844 TGATATCTCCAGGAGAAAAAAGG + Intronic
1150461710 17:65359177-65359199 TGGTTTCTGCAGGAAGGAATGGG + Intergenic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1151535062 17:74734529-74734551 TTTTCATTGCAGGAGGGAAATGG - Intronic
1151761577 17:76106640-76106662 TCATCTCTGCAAGTGGGAAGTGG - Intronic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1152813959 17:82396819-82396841 TCATCTCTGCATTAGGGGAAGGG - Intronic
1155881388 18:31153132-31153154 TGATCATTGCCAGAGGGAAAAGG - Intronic
1156735777 18:40257219-40257241 TGATTTCTGCAGGAAAGAATAGG - Intergenic
1157161326 18:45316792-45316814 TGATTCCTGAAGGATGGAAAAGG - Intronic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1157298415 18:46462330-46462352 TAAGCTGTGAAGGAGGGAAAGGG - Exonic
1159154500 18:64565249-64565271 TTATTTCTGCAGAAGGAAAAGGG - Intergenic
1159657997 18:71056059-71056081 TCATCTTTACAAGAGGGAAAGGG - Intergenic
1160362572 18:78296333-78296355 ATATCTGTGCAGGAAGGAAAAGG + Intergenic
1160403037 18:78624968-78624990 TGTTCTGTGCAGGATGGAAAGGG + Intergenic
1162183880 19:8889535-8889557 TGAGCTGTGGAGGAGGGAGAGGG + Exonic
1162187211 19:8914979-8915001 TGAGCTGTGGAGGAGGGAGAGGG + Exonic
1162925114 19:13926961-13926983 TGAACTCTGCAGGAGGAAGGAGG - Exonic
1163177959 19:15577609-15577631 TTAGCTCTTCAGGTGGGAAAGGG + Intergenic
1165716329 19:38048118-38048140 AAATCTCTGTAGGAGGGAAATGG - Intronic
1165743920 19:38219138-38219160 TGCTCTTTGCAGGAGGGAAGAGG + Intronic
1165782084 19:38440863-38440885 AGGTCTGTGCAGGAGGGAGAGGG + Exonic
1167687892 19:50968054-50968076 TGATTGCTGCAGGTGGGGAAAGG - Exonic
1167734601 19:51285230-51285252 TGTTATCTGGAGGAGGGTAAAGG - Intergenic
1168298722 19:55390856-55390878 TGAGGTCTAGAGGAGGGAAATGG - Intronic
1168313778 19:55474893-55474915 TGGTCTCTGCAGTAGTGAAAGGG - Intergenic
925146254 2:1585136-1585158 TGAGCTCTGATGGATGGAAAAGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925654614 2:6132632-6132654 TGACCTCTGTAACAGGGAAATGG + Intergenic
926236405 2:11048397-11048419 TGACCTTTGCAGGAGTGGAATGG + Intergenic
927855736 2:26526670-26526692 TGATCTGAGCAGGAGAGACAAGG - Intronic
927945212 2:27131503-27131525 CACTCCCTGCAGGAGGGAAAGGG + Exonic
928325313 2:30315010-30315032 TGATTTCTGAAGGAGGACAAAGG - Intronic
928778649 2:34794250-34794272 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
929409377 2:41679919-41679941 TAATATATGAAGGAGGGAAATGG - Intergenic
931382124 2:61763952-61763974 TGACCTCAGAAGGAGGAAAACGG + Intergenic
932369078 2:71172831-71172853 TGACCTCTGCATGAAGGATAGGG + Intergenic
932598957 2:73111394-73111416 TGATCTGGGTAGGAGGGTAAGGG - Intronic
932959663 2:76397878-76397900 TGACCTTTGCAGCAGGAAAAAGG - Intergenic
934112572 2:88756871-88756893 TGGTCTCTTCAGGAGGCAAAGGG + Intergenic
934715668 2:96541962-96541984 GGCTCTGTGGAGGAGGGAAAAGG - Intronic
935403534 2:102684932-102684954 TAAGCTCTGCAGCAGGGACAGGG - Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936043538 2:109168475-109168497 GGCTCTCAGCAGGAGGGAGAGGG + Intronic
936163781 2:110103332-110103354 TGGTCTCTTCAGGAGGCAAAGGG + Intronic
936519988 2:113205813-113205835 TCAGCTCAGCAGGAGGAAAAAGG - Intronic
937325457 2:120987427-120987449 TGGTCACTGCAGGAGTGTAAAGG + Intronic
937387301 2:121447296-121447318 AGAGCAGTGCAGGAGGGAAAGGG + Intronic
938404993 2:131027390-131027412 ATATCTCTACAGGAGGGAGATGG + Intronic
938570941 2:132561309-132561331 TGATTTCTGTAGAAGAGAAATGG - Intronic
940530621 2:154872525-154872547 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
940900207 2:159119866-159119888 TGATGTTTGCAAGAGGGAAGAGG + Intronic
941455563 2:165709617-165709639 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
942034038 2:171993483-171993505 TCATCACTTCATGAGGGAAAGGG + Intronic
943063999 2:183068669-183068691 TGCTGGCTGCAGGAGGGATAGGG + Intergenic
943412360 2:187559975-187559997 TGAATTCTTCAGGAGGGTAAAGG + Intronic
943865721 2:192922822-192922844 TGAGCTCTTCAGGAGGGTAAAGG - Intergenic
946277506 2:218642546-218642568 TGGTCTCTGCAGGAGAGCCAGGG + Exonic
946940994 2:224770107-224770129 TGATTTCTGCAGCAAGAAAAGGG + Intronic
947084623 2:226437111-226437133 TGATCTCAGCAGAGGTGAAATGG - Intergenic
947679630 2:232018388-232018410 TGTTCTTTGCAGATGGGAAAAGG + Intronic
948801288 2:240434809-240434831 TGACCTCTGGAGAAGGGATAGGG - Intergenic
948908548 2:240991629-240991651 TGCTCTCTGCCGGAGGGGAAGGG - Intronic
1168739651 20:176790-176812 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1168938535 20:1689106-1689128 TGGTCACAGCAGGAGGGACAGGG + Intergenic
1169258541 20:4118343-4118365 TGAGCGCTGCAGGAGGCACAAGG + Intergenic
1169740919 20:8893418-8893440 TGATCTCTGAAGAAGGCTAAGGG + Intronic
1170440044 20:16369883-16369905 TGCTCTGTAGAGGAGGGAAATGG + Intronic
1170600040 20:17835178-17835200 TTGCCTCTGCAGGGGGGAAATGG + Intergenic
1170715015 20:18823854-18823876 TGCTCTTTGCATGAGGAAAAGGG + Intronic
1171345085 20:24459872-24459894 TTGACTCTGCAGGAGGGAAGCGG + Intergenic
1174860435 20:54086310-54086332 GAATCTCTGCAGGTGGGAGAAGG + Intergenic
1175230512 20:57470775-57470797 TGATCTCTGCGGGAGGGGTGGGG + Intergenic
1175647456 20:60686959-60686981 GGAGGTCTGGAGGAGGGAAAAGG + Intergenic
1179162412 21:38909309-38909331 CTATCTCAGCAGGAGGGAAAAGG + Intergenic
1179353450 21:40635260-40635282 GGATGTCAGCAGGAGGGAAAAGG + Intronic
1179635401 21:42705490-42705512 TGATCACAGCACGCGGGAAAAGG + Intronic
1180158971 21:45990587-45990609 TGATCCCGGCAGGAGGGACAGGG + Intronic
1181720225 22:24768559-24768581 TGATGTCTGCAGAATGAAAAAGG - Intronic
1181961406 22:26624590-26624612 TGATTTGTGCAGGTGGGGAATGG + Intronic
1182467092 22:30524147-30524169 TGGTTTCTGCAGGAAGGAACTGG - Exonic
1183454053 22:37911935-37911957 AAATCTCTGCAAGAGGCAAAGGG - Exonic
1184213659 22:43052038-43052060 TGAGCTCTGCGGGAGGAAGAGGG - Intronic
1184649793 22:45914468-45914490 TGATCTCCGCATGATGGAGAGGG - Intergenic
1184720931 22:46312819-46312841 AGAACTCTACATGAGGGAAACGG - Intronic
1184854529 22:47139188-47139210 TGGTCGCTGCAGGAGCGGAACGG - Intronic
949928489 3:9060087-9060109 TGAGCCCTGCTGGAGGGGAAGGG - Intronic
951331978 3:21379699-21379721 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
951762193 3:26159653-26159675 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
952597979 3:35042574-35042596 TATTCTCTGCAGTATGGAAAAGG + Intergenic
952615287 3:35263603-35263625 GTATCTCTGCAGCAGGGTAATGG + Intergenic
953375605 3:42425928-42425950 TGACCTCTGCAGGAGGAGAGAGG - Intergenic
953505179 3:43479082-43479104 TAATCTATGCACGAGTGAAAAGG - Intronic
953743084 3:45553661-45553683 GCAACTCTGCAGGAGGGAAGGGG + Intergenic
953873322 3:46646632-46646654 TGTTTTCTGCAGGAAGGAATGGG + Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
956883865 3:73538709-73538731 TGTTCTATGCAGGAGAAAAATGG - Intronic
957180843 3:76875559-76875581 TGACCTCTGGAGGCTGGAAAAGG - Intronic
958867744 3:99520756-99520778 TGCTCTCTGCAGCCAGGAAAAGG + Intergenic
960639817 3:119814287-119814309 TGATCCCTGCAGGACCGGAAGGG + Intronic
962160577 3:132995277-132995299 TCATATATCCAGGAGGGAAAGGG + Intergenic
962313272 3:134340880-134340902 TTATCTGTGAGGGAGGGAAAAGG + Intergenic
962502669 3:136010820-136010842 TGATGACTGCAGGGGAGAAATGG - Intronic
962510128 3:136090634-136090656 TGATCTCTGAAGAAGACAAAAGG + Exonic
962810721 3:138957071-138957093 TGATCACCTCAAGAGGGAAAAGG - Intergenic
962987636 3:140550111-140550133 AAATCACTGCAGGAGGAAAAAGG + Intronic
962987799 3:140551562-140551584 AAATCACTGCAGGAGGAAAAAGG + Intronic
963059004 3:141209710-141209732 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
963328538 3:143888941-143888963 TGATCTCTCCAGAGGAGAAATGG - Intergenic
963602646 3:147391395-147391417 CGCTCTCTGCACGAGGGAAAGGG - Intronic
964081070 3:152758049-152758071 AGATCACTGCAGAAGAGAAAGGG + Intergenic
964090467 3:152870202-152870224 TGATTTCTACAGAAGGGACATGG + Intergenic
965335709 3:167429170-167429192 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
965625896 3:170683839-170683861 TGAGTTCTTCAGGAGGGTAAAGG + Intronic
965841175 3:172907289-172907311 TGATCTATTCAGAAGGGCAAAGG - Intronic
966067429 3:175834162-175834184 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
966279735 3:178212833-178212855 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
967193549 3:187006179-187006201 TGATCTCTGTAAGAGGCAAATGG - Intronic
967404411 3:189099791-189099813 AGATTTCAGCAGGATGGAAAGGG - Intronic
967706681 3:192659465-192659487 TGATTTCTGCAGGTTGGAGAGGG - Intronic
969155173 4:5203839-5203861 GCATCTCTGCAGGAGTGCAAGGG - Intronic
969548996 4:7851842-7851864 TGATCTCTTCATGATGGAAGTGG - Intronic
971478668 4:27095277-27095299 TGTTCTTTGCAGGATGGAGAAGG - Intergenic
972664102 4:41147100-41147122 TAATGTCTGCAGCAGGCAAACGG + Intronic
972725405 4:41743079-41743101 TGATCTCTTTTGGAGGGAAGGGG - Intergenic
973175372 4:47198838-47198860 TGATCATGGCAGGAGGCAAAGGG + Intronic
974020606 4:56688760-56688782 TGTTCTCTGACAGAGGGAAATGG + Intergenic
974732939 4:65893471-65893493 TCCTCTTTGCAGGAGAGAAAAGG + Intergenic
977008097 4:91597836-91597858 TGCTCTCTTCAGGAGGAATATGG + Intronic
977042178 4:92029082-92029104 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
977499240 4:97818011-97818033 AGATTTCTACAGGAAGGAAATGG - Intronic
979807884 4:124997281-124997303 TGGTCTGTGCAGGAGTCAAAAGG - Intergenic
980430815 4:132691378-132691400 ACCTCTCTGCAGGAGCGAAAAGG - Intergenic
980706097 4:136497840-136497862 TGTTCTCTGCAGTTGGGAAGAGG - Intergenic
981646947 4:147009710-147009732 AGAGCTGTGAAGGAGGGAAAGGG - Intergenic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
982351200 4:154416987-154417009 TGATCCCTGCAGCTGGGAGAGGG - Intronic
982692056 4:158560012-158560034 TAATGTCTGCAGGAAGAAAAAGG + Intronic
983939641 4:173526008-173526030 TCATCTGAGCAGGCGGGAAAGGG - Intronic
984165000 4:176295999-176296021 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
984438113 4:179729230-179729252 TGGTTTCTGCAGGAAGGAAGGGG + Intergenic
984702993 4:182830280-182830302 GGCTCTGTGCAGGAGGCAAAGGG - Intergenic
984785748 4:183565907-183565929 TGATGTTTGAAGGAAGGAAAAGG + Intergenic
986134174 5:4958877-4958899 GCATCTCTGCAGGAGGAAACGGG - Intergenic
986148539 5:5104663-5104685 TGGTTTCTGCAGGAAGGAACAGG - Intergenic
987258541 5:16180425-16180447 TGCTCACTGCAGGAGGGAGCGGG - Intronic
988899145 5:35712832-35712854 GAATCTCTTCAGGAAGGAAAAGG + Exonic
990041696 5:51384487-51384509 TTATCTCTGTAGGAAGTAAACGG + Intronic
990738436 5:58888721-58888743 TGGTTTTTGAAGGAGGGAAAAGG - Intergenic
992785900 5:80170399-80170421 AGATCTCTACAGAAGGCAAAAGG - Intronic
992821883 5:80505794-80505816 TCATCTGGGCTGGAGGGAAATGG + Intronic
994667023 5:102717173-102717195 TGAGCTTGGCAGGAGGAAAAAGG + Intergenic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995029274 5:107461553-107461575 TGATCTAAGCAAGAGAGAAAAGG + Intronic
995124820 5:108569647-108569669 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
995343231 5:111083508-111083530 TGCTCTGTGCAGAAGGGAAAAGG + Intergenic
996358130 5:122618937-122618959 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
996398230 5:123034421-123034443 TGGTGGCTGCAGGAGGGGAAGGG - Intronic
997791846 5:136769045-136769067 TGAGCTGGGCAGGAGGGAGAGGG + Intergenic
999840665 5:155422374-155422396 TGTTCTCAACAGGAGGGAAGTGG - Intergenic
1001744174 5:174077945-174077967 AGAACTATGAAGGAGGGAAAGGG - Intronic
1002053792 5:176586776-176586798 TGATCACTGCAGGTGTGAACGGG - Exonic
1002534725 5:179869930-179869952 TGACCTCTCCAGGAGGGAGTTGG - Intronic
1003588025 6:7411005-7411027 TTTTCTGAGCAGGAGGGAAAGGG - Intronic
1004449170 6:15728853-15728875 TGAGCTCTGCAGGAGAGGGAAGG - Intergenic
1004985451 6:21077557-21077579 TAATCACTGCAGAAGGCAAAGGG + Intronic
1006630807 6:35428349-35428371 TTCTCTCTGCAGGGCGGAAATGG - Intergenic
1007070965 6:39037837-39037859 TGATGCCTGCAGGAGGGAGGAGG + Intergenic
1007424922 6:41740605-41740627 TGCTGGCTGCAGGAGAGAAAGGG + Exonic
1008259735 6:49350151-49350173 TGATGTCTGCTGGAGGTAAGTGG - Intergenic
1008716167 6:54292634-54292656 TGATCTCTACACAAGTGAAAGGG - Intergenic
1008849863 6:56011980-56012002 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
1009343810 6:62589719-62589741 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1010563033 6:77374196-77374218 TGGTTTCTGCAGGAAGAAAAGGG - Intergenic
1010648233 6:78420026-78420048 TGGTCTCTCCAAGAGAGAAAGGG - Intergenic
1012260349 6:97081200-97081222 TGGTATCTGCAGGAAGGAAGTGG + Intronic
1013074628 6:106760426-106760448 TTATCTCTGGAGAAGAGAAAGGG + Intergenic
1014283208 6:119465048-119465070 TGATGTCTACAGGAGGTGAAGGG - Intergenic
1015601967 6:134918948-134918970 TCATCTCGGAAGGAGGGATAAGG + Intronic
1016205047 6:141458685-141458707 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1016247722 6:142005440-142005462 TGATCTCAGGGGGAAGGAAATGG - Intergenic
1019138289 6:169926133-169926155 TGTTCTCTTCAGGAGGGCATGGG - Intergenic
1019954147 7:4399669-4399691 TGATCTGAGGAGGAGGCAAAGGG + Intergenic
1020272434 7:6605362-6605384 GGATTCCTGCAGGAGGGGAAAGG - Intronic
1020481751 7:8669725-8669747 TACTCTCTGCTTGAGGGAAAGGG - Intronic
1021040554 7:15857007-15857029 TGCTCTCTGGAAGAGGCAAAAGG - Intergenic
1021146325 7:17093514-17093536 TAGTCTCTGCAGGAGGAAGAAGG + Intergenic
1022092521 7:27117029-27117051 TGCTCCTTGCAGTAGGGAAAGGG - Intronic
1022373364 7:29790479-29790501 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1022542096 7:31146852-31146874 TAATCTGTGCAGTAGGGGAAGGG - Intergenic
1022717054 7:32908091-32908113 TGATCACTGCAGGGCAGAAACGG - Intergenic
1022991370 7:35711284-35711306 AGTTCTCTGCAGAAGGGGAAAGG + Intergenic
1023990163 7:45124046-45124068 TGTTCTCTGCAGGGGGGCACGGG + Intergenic
1024382107 7:48708778-48708800 TGGTTTCTGCAGGAATGAAAGGG - Intergenic
1024472470 7:49777192-49777214 CGCCCTCTGCAGGTGGGAAAAGG - Intronic
1024692695 7:51820042-51820064 TAATCACTTCAGGATGGAAAAGG + Intergenic
1028289266 7:89045041-89045063 TGCTCTCTGCAGTTGGGACATGG + Intronic
1028720865 7:94029644-94029666 TGTTCTCTACAGAAGGCAAATGG - Intergenic
1030273404 7:107694021-107694043 TGATCTCTGTTGTTGGGAAAGGG + Intronic
1031160010 7:118155238-118155260 TGATTTTTGCAGGAGGGAAGGGG - Intergenic
1031192430 7:118570950-118570972 TAATCACTGCAGAAGGCAAAGGG + Intergenic
1035165904 7:156989791-156989813 TGATCTCTGCGGGGGAGAGAGGG - Intergenic
1035283106 7:157789490-157789512 AGGTCTCTGCCGGAGAGAAAAGG + Intronic
1035675325 8:1451866-1451888 TGAGCTCTGGTGGAGGGAACAGG - Intergenic
1037760964 8:21741271-21741293 AGAAGTTTGCAGGAGGGAAAGGG - Intronic
1037905276 8:22712710-22712732 TGATTTCTGACGGAGAGAAAGGG - Intergenic
1038077139 8:24089088-24089110 TGATTTTTGCAGAAGGGAGAAGG + Intergenic
1038117696 8:24576241-24576263 TGACTTCTGCAGCAGGGTAAAGG - Intergenic
1038442048 8:27577587-27577609 TGACCTCAGCAGGAGGAAAAGGG - Intergenic
1039884702 8:41648323-41648345 AAACCTCTGCAGGAGGGAGAGGG - Intronic
1041407439 8:57515679-57515701 TGATCTCTGCTGGAGGGTGAAGG + Intergenic
1043473703 8:80585657-80585679 GGATTTCTGCAGCAGGGAGATGG - Intergenic
1044113952 8:88311249-88311271 TGATATATCCAGGAGGTAAAAGG + Intronic
1044438147 8:92190101-92190123 GGATATCTGCTGGAGGGCAAAGG + Intergenic
1046671416 8:117060632-117060654 TTGTCTCTGGAGTAGGGAAATGG - Intronic
1047292605 8:123542624-123542646 TGGTCTCTGTTGGAGGGAATTGG + Intergenic
1048283027 8:133119310-133119332 TGAGCTCTGCAGGGTTGAAATGG + Intronic
1048333468 8:133486530-133486552 TGATGTTTTCTGGAGGGAAACGG - Intronic
1048607989 8:135990156-135990178 CGACCTCAGCAGGAGGGTAAGGG - Intergenic
1048791214 8:138105697-138105719 TGGTCTTTCCAGGAGGGCAATGG + Intergenic
1049244015 8:141551850-141551872 TGGTGCCTGCAGGAGGGACATGG - Intergenic
1049438639 8:142599174-142599196 TGACCTCTGCGGGAGGGAGCTGG - Intergenic
1050308999 9:4333962-4333984 TGACCTCTGCAGGAGAGGAAAGG + Intronic
1050528008 9:6562992-6563014 TTCACTCTGCAGGAGGGAGAGGG - Intronic
1051531244 9:18106128-18106150 TGATATGTGCTTGAGGGAAAGGG + Intergenic
1051542522 9:18235753-18235775 AGATCAATGCAGGAGGCAAAGGG - Intergenic
1052653909 9:31332610-31332632 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1052888768 9:33676711-33676733 GGGGCTCTGCAGGATGGAAATGG + Intergenic
1053224568 9:36342179-36342201 TGATCTCTGCAAATGAGAAAAGG - Intronic
1055312548 9:74998017-74998039 TGAGCTAGGCAGGAGAGAAAGGG - Intronic
1055325973 9:75130083-75130105 TGATTTGTGCAGTTGGGAAATGG + Intronic
1055347371 9:75352947-75352969 TGAGTTCTTCAGGAGGGTAAAGG + Intergenic
1056324467 9:85464858-85464880 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1056878930 9:90369635-90369657 TGTTCTCTCCAGGAGAGCAATGG + Intergenic
1057746113 9:97752658-97752680 TGAACTATGCAGGAAGGCAAAGG - Intergenic
1057795875 9:98157655-98157677 TGACATCTGCAGGAGACAAATGG + Exonic
1057917177 9:99065744-99065766 TGTCCTCTGCAGGAAGGAAAGGG + Intronic
1057948984 9:99354652-99354674 TAATCTCTGCAGGAATTAAATGG - Intergenic
1057962441 9:99469613-99469635 TGTTCCCTCCAGCAGGGAAAGGG + Intergenic
1058722202 9:107774258-107774280 TGATCATGGCAGGAGGGAAGGGG + Intergenic
1058804432 9:108577353-108577375 AGACCTTTGCAGGTGGGAAATGG + Intergenic
1059888736 9:118776834-118776856 TTTTATCTGGAGGAGGGAAAGGG + Intergenic
1060523742 9:124309003-124309025 GGCTCTCAGCAGAAGGGAAAGGG - Intronic
1062062159 9:134502461-134502483 TGCTCCCTGCAGGAGGAAAGAGG - Intergenic
1062221641 9:135419264-135419286 TGAGCTCAGAAGGAGGGAGAGGG - Intergenic
1062352406 9:136145591-136145613 TGATGTCTGCAGAGAGGAAATGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1062699832 9:137893049-137893071 GGCTCTCTCCAGGAGGGCAAAGG + Intronic
1186815862 X:13237448-13237470 TTATCTCTGCAAGAGAGAAAGGG + Intergenic
1187328200 X:18311518-18311540 AGAAATCTGAAGGAGGGAAATGG + Intronic
1187344352 X:18449390-18449412 TGATGTCTGCAATAGAGAAAAGG - Intronic
1187386594 X:18854407-18854429 TGATCTTTCCAGGAGTGAAAAGG - Intergenic
1188223809 X:27572635-27572657 GGACATGTGCAGGAGGGAAAAGG + Intergenic
1188770775 X:34150916-34150938 TGATCTCTACTGGAGGAAAGAGG - Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1189713169 X:43836598-43836620 TGACCTCTGCTGGAGGAAATGGG - Intronic
1190113944 X:47613484-47613506 TGTTCTTTGCAGGATGGAAGGGG - Intronic
1191761914 X:64655552-64655574 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic
1194036783 X:88884837-88884859 TGATGTCTACTTGAGGGAAAAGG - Intergenic
1194071898 X:89335332-89335354 TGAATTGTGGAGGAGGGAAAAGG - Intergenic
1194782048 X:98035689-98035711 TTATCTCTGGAGGAGGCAAGGGG + Intergenic
1195084673 X:101402934-101402956 TGAACTCTCTAGGAGGAAAAAGG - Intronic
1199048330 X:143204375-143204397 TGACCTCTGCAGGGGGAAAAAGG + Intergenic
1200401163 X:156021291-156021313 TGACCTCTGCAGAGGGGGAACGG - Intergenic
1200474526 Y:3628474-3628496 AGGTCTCTGCAGGAGGGTGAGGG + Intergenic
1200726142 Y:6671061-6671083 TGAATTGTGGAGGAGGGAAAAGG - Intergenic
1201937710 Y:19425623-19425645 TGAGTTCTTCAGGAGGGTAAAGG - Intergenic