ID: 1151437887

View in Genome Browser
Species Human (GRCh38)
Location 17:74109421-74109443
Sequence AGGTACTGCCCCGGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151437879_1151437887 14 Left 1151437879 17:74109384-74109406 CCATAAAAGAGCTAAATGAATGG No data
Right 1151437887 17:74109421-74109443 AGGTACTGCCCCGGAGCAGAGGG No data
1151437878_1151437887 15 Left 1151437878 17:74109383-74109405 CCCATAAAAGAGCTAAATGAATG No data
Right 1151437887 17:74109421-74109443 AGGTACTGCCCCGGAGCAGAGGG No data
1151437877_1151437887 27 Left 1151437877 17:74109371-74109393 CCACAGAGGCAGCCCATAAAAGA No data
Right 1151437887 17:74109421-74109443 AGGTACTGCCCCGGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151437887 Original CRISPR AGGTACTGCCCCGGAGCAGA GGG Intergenic
No off target data available for this crispr