ID: 1151438093

View in Genome Browser
Species Human (GRCh38)
Location 17:74110738-74110760
Sequence CACTTCCCACACACTTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151438093_1151438101 17 Left 1151438093 17:74110738-74110760 CCCACGCAAGTGTGTGGGAAGTG No data
Right 1151438101 17:74110778-74110800 TAATCTGTCTGCTCCTCCCAGGG No data
1151438093_1151438100 16 Left 1151438093 17:74110738-74110760 CCCACGCAAGTGTGTGGGAAGTG No data
Right 1151438100 17:74110777-74110799 GTAATCTGTCTGCTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151438093 Original CRISPR CACTTCCCACACACTTGCGT GGG (reversed) Intergenic
No off target data available for this crispr