ID: 1151438662

View in Genome Browser
Species Human (GRCh38)
Location 17:74114387-74114409
Sequence GCTGCTGTTGAGAGCCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151438662_1151438667 20 Left 1151438662 17:74114387-74114409 CCCTTCTGGCTCTCAACAGCAGC No data
Right 1151438667 17:74114430-74114452 TGGTCGCCATCCAGGCCTCCAGG No data
1151438662_1151438665 0 Left 1151438662 17:74114387-74114409 CCCTTCTGGCTCTCAACAGCAGC No data
Right 1151438665 17:74114410-74114432 AGTGGAACATCTTAAACATATGG No data
1151438662_1151438666 12 Left 1151438662 17:74114387-74114409 CCCTTCTGGCTCTCAACAGCAGC No data
Right 1151438666 17:74114422-74114444 TAAACATATGGTCGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151438662 Original CRISPR GCTGCTGTTGAGAGCCAGAA GGG (reversed) Intergenic
No off target data available for this crispr