ID: 1151443224

View in Genome Browser
Species Human (GRCh38)
Location 17:74147231-74147253
Sequence GACCCACTCCGTGTTATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151443224_1151443225 -3 Left 1151443224 17:74147231-74147253 CCTGTAATAACACGGAGTGGGTC No data
Right 1151443225 17:74147251-74147273 GTCACCTGCTTAAGAAACAGTGG No data
1151443224_1151443227 4 Left 1151443224 17:74147231-74147253 CCTGTAATAACACGGAGTGGGTC No data
Right 1151443227 17:74147258-74147280 GCTTAAGAAACAGTGGATTAAGG No data
1151443224_1151443228 10 Left 1151443224 17:74147231-74147253 CCTGTAATAACACGGAGTGGGTC No data
Right 1151443228 17:74147264-74147286 GAAACAGTGGATTAAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151443224 Original CRISPR GACCCACTCCGTGTTATTAC AGG (reversed) Intergenic
No off target data available for this crispr