ID: 1151443228

View in Genome Browser
Species Human (GRCh38)
Location 17:74147264-74147286
Sequence GAAACAGTGGATTAAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151443221_1151443228 14 Left 1151443221 17:74147227-74147249 CCGGCCTGTAATAACACGGAGTG No data
Right 1151443228 17:74147264-74147286 GAAACAGTGGATTAAGGAGAAGG No data
1151443224_1151443228 10 Left 1151443224 17:74147231-74147253 CCTGTAATAACACGGAGTGGGTC No data
Right 1151443228 17:74147264-74147286 GAAACAGTGGATTAAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151443228 Original CRISPR GAAACAGTGGATTAAGGAGA AGG Intergenic
No off target data available for this crispr