ID: 1151444433

View in Genome Browser
Species Human (GRCh38)
Location 17:74153910-74153932
Sequence GGGTCCTCAGAGAAGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151444433_1151444436 -2 Left 1151444433 17:74153910-74153932 CCAGCTCACTTCTCTGAGGACCC No data
Right 1151444436 17:74153931-74153953 CCAACACAGCCTCCATCTTCTGG No data
1151444433_1151444440 13 Left 1151444433 17:74153910-74153932 CCAGCTCACTTCTCTGAGGACCC No data
Right 1151444440 17:74153946-74153968 TCTTCTGGACAGGCCAGCTGAGG No data
1151444433_1151444437 3 Left 1151444433 17:74153910-74153932 CCAGCTCACTTCTCTGAGGACCC No data
Right 1151444437 17:74153936-74153958 ACAGCCTCCATCTTCTGGACAGG No data
1151444433_1151444443 29 Left 1151444433 17:74153910-74153932 CCAGCTCACTTCTCTGAGGACCC No data
Right 1151444443 17:74153962-74153984 GCTGAGGCCCAGCATCACCCGGG No data
1151444433_1151444442 28 Left 1151444433 17:74153910-74153932 CCAGCTCACTTCTCTGAGGACCC No data
Right 1151444442 17:74153961-74153983 AGCTGAGGCCCAGCATCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151444433 Original CRISPR GGGTCCTCAGAGAAGTGAGC TGG (reversed) Intergenic
No off target data available for this crispr