ID: 1151445126

View in Genome Browser
Species Human (GRCh38)
Location 17:74158630-74158652
Sequence CTGTCTGCACTGATTTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151445121_1151445126 8 Left 1151445121 17:74158599-74158621 CCCCTCTAGACTGTAGAGATGTT No data
Right 1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG No data
1151445122_1151445126 7 Left 1151445122 17:74158600-74158622 CCCTCTAGACTGTAGAGATGTTT No data
Right 1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG No data
1151445123_1151445126 6 Left 1151445123 17:74158601-74158623 CCTCTAGACTGTAGAGATGTTTA No data
Right 1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG No data
1151445119_1151445126 26 Left 1151445119 17:74158581-74158603 CCCTAGTAAATATCTCAACCCCT No data
Right 1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG No data
1151445120_1151445126 25 Left 1151445120 17:74158582-74158604 CCTAGTAAATATCTCAACCCCTC No data
Right 1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151445126 Original CRISPR CTGTCTGCACTGATTTAGGC TGG Intergenic
No off target data available for this crispr