ID: 1151447149

View in Genome Browser
Species Human (GRCh38)
Location 17:74174645-74174667
Sequence CACGCCCAGATGATTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151447149_1151447155 9 Left 1151447149 17:74174645-74174667 CCAAAAAAAATCATCTGGGCGTG No data
Right 1151447155 17:74174677-74174699 ACCTGTAGTCCCAGCTACTCGGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
1151447149_1151447157 12 Left 1151447149 17:74174645-74174667 CCAAAAAAAATCATCTGGGCGTG No data
Right 1151447157 17:74174680-74174702 TGTAGTCCCAGCTACTCGGGAGG 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
1151447149_1151447160 29 Left 1151447149 17:74174645-74174667 CCAAAAAAAATCATCTGGGCGTG No data
Right 1151447160 17:74174697-74174719 GGGAGGCTGAAGCAGAAGAATGG 0: 43
1: 2974
2: 65137
3: 44552
4: 18182
1151447149_1151447154 8 Left 1151447149 17:74174645-74174667 CCAAAAAAAATCATCTGGGCGTG No data
Right 1151447154 17:74174676-74174698 CACCTGTAGTCCCAGCTACTCGG 0: 27099
1: 99923
2: 128146
3: 148395
4: 176885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151447149 Original CRISPR CACGCCCAGATGATTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr