ID: 1151451627

View in Genome Browser
Species Human (GRCh38)
Location 17:74201547-74201569
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151451627_1151451634 7 Left 1151451627 17:74201547-74201569 CCATCCACCACCCCTTTATATGG No data
Right 1151451634 17:74201577-74201599 TCTCAGATGCCGCATCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151451627 Original CRISPR CCATATAAAGGGGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr