ID: 1151451638

View in Genome Browser
Species Human (GRCh38)
Location 17:74201605-74201627
Sequence GTGCTCAATGCTAACATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151451638_1151451639 -8 Left 1151451638 17:74201605-74201627 CCTGCAATGTTAGCATTGAGCAC No data
Right 1151451639 17:74201620-74201642 TTGAGCACTTACTGTACAGATGG No data
1151451638_1151451640 -7 Left 1151451638 17:74201605-74201627 CCTGCAATGTTAGCATTGAGCAC No data
Right 1151451640 17:74201621-74201643 TGAGCACTTACTGTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151451638 Original CRISPR GTGCTCAATGCTAACATTGC AGG (reversed) Intergenic
No off target data available for this crispr