ID: 1151453165

View in Genome Browser
Species Human (GRCh38)
Location 17:74211659-74211681
Sequence CACTTTCCCCAGCAACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151453157_1151453165 28 Left 1151453157 17:74211608-74211630 CCTGGGGGGCCTCTGAGGGCAGG No data
Right 1151453165 17:74211659-74211681 CACTTTCCCCAGCAACTGCAGGG No data
1151453161_1151453165 19 Left 1151453161 17:74211617-74211639 CCTCTGAGGGCAGGGGCTGTAAA No data
Right 1151453165 17:74211659-74211681 CACTTTCCCCAGCAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151453165 Original CRISPR CACTTTCCCCAGCAACTGCA GGG Intergenic
No off target data available for this crispr