ID: 1151453396

View in Genome Browser
Species Human (GRCh38)
Location 17:74212700-74212722
Sequence TGCCGAACGCAGGCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151453396_1151453407 20 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453407 17:74212743-74212765 CCTCTGCGGTGCCTGCGCTCGGG No data
1151453396_1151453405 19 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453405 17:74212742-74212764 CCCTCTGCGGTGCCTGCGCTCGG No data
1151453396_1151453403 6 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453403 17:74212729-74212751 CGGGTCGTCATCGCCCTCTGCGG No data
1151453396_1151453410 27 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453410 17:74212750-74212772 GGTGCCTGCGCTCGGGGTGAGGG No data
1151453396_1151453409 26 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453409 17:74212749-74212771 CGGTGCCTGCGCTCGGGGTGAGG No data
1151453396_1151453408 21 Left 1151453396 17:74212700-74212722 CCCCTCCTGGCCTGCGTTCGGCA No data
Right 1151453408 17:74212744-74212766 CTCTGCGGTGCCTGCGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151453396 Original CRISPR TGCCGAACGCAGGCCAGGAG GGG (reversed) Intergenic
No off target data available for this crispr