ID: 1151456852

View in Genome Browser
Species Human (GRCh38)
Location 17:74231670-74231692
Sequence TTTTTCTTTAATTTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187819
Summary {0: 1, 1: 88, 2: 1903, 3: 98483, 4: 87344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151456852_1151456854 13 Left 1151456852 17:74231670-74231692 CCATCTCAAAAATTAAAGAAAAA 0: 1
1: 88
2: 1903
3: 98483
4: 87344
Right 1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 53
1151456852_1151456853 7 Left 1151456852 17:74231670-74231692 CCATCTCAAAAATTAAAGAAAAA 0: 1
1: 88
2: 1903
3: 98483
4: 87344
Right 1151456853 17:74231700-74231722 TTGAAGAGCCCCGTGATGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151456852 Original CRISPR TTTTTCTTTAATTTTTGAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr