ID: 1151456854

View in Genome Browser
Species Human (GRCh38)
Location 17:74231706-74231728
Sequence AGCCCCGTGATGTAAGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151456852_1151456854 13 Left 1151456852 17:74231670-74231692 CCATCTCAAAAATTAAAGAAAAA 0: 1
1: 88
2: 1903
3: 98483
4: 87344
Right 1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151456854 Original CRISPR AGCCCCGTGATGTAAGGTAG TGG Intronic
901185487 1:7370044-7370066 AGTGCCGTGATGTAAGCAAGGGG - Intronic
903178403 1:21593653-21593675 AGGCCCCTGCTGTGAGGTAGGGG + Intergenic
903994443 1:27296959-27296981 GACCCCGTGATGGAAGCTAGAGG + Intronic
923525176 1:234767093-234767115 AGCTCCGAGATGGAAGGGAGAGG + Intergenic
923774454 1:236966015-236966037 AGCCCTGTTTTGTAAGGAAGAGG - Intergenic
1064865985 10:19880754-19880776 AACAGCATGATGTAAGGTAGAGG - Intronic
1066224432 10:33368534-33368556 AGACCTGTGAAGTAGGGTAGGGG + Intergenic
1070359173 10:75670832-75670854 AGTCCCCTGAGGTAAGGGAGCGG - Intronic
1070792108 10:79195672-79195694 AGCCCAGTGATGTAAGTGACTGG + Intronic
1076816070 10:132915296-132915318 AGCCCCGTCATTTCAGGCAGGGG - Intronic
1080719905 11:34838615-34838637 AGCCCTGAGATGGGAGGTAGAGG - Intergenic
1091613552 12:2032064-2032086 ATCCCCATGCTGCAAGGTAGAGG + Intronic
1098435984 12:70468512-70468534 AGCCCCTGGAGGTAAGGGAGAGG - Intergenic
1099812752 12:87605603-87605625 ATTTCCTTGATGTAAGGTAGAGG - Intergenic
1106284665 13:28308294-28308316 AGCCCTGTGATGTGGGGTTGAGG - Intronic
1106303496 13:28490439-28490461 AGCCCCGTGAGCTAAGTCAGAGG + Intronic
1118446033 14:65851956-65851978 AGCAACGTGATGTACGCTAGTGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1144449552 17:15364704-15364726 AGCCTCGTGAGGTCAGGGAGGGG + Intergenic
1146916143 17:36679683-36679705 AGCCCCTTGATGAAAGGGAAAGG - Intergenic
1147904441 17:43813712-43813734 GGCCCCGTGGTGTCAGGTTGAGG + Intronic
1148666157 17:49376596-49376618 AGCCCAGAGCTGTAAGGTAATGG + Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152077677 17:78169093-78169115 AGCCACGTGGGGTAAGGGAGGGG + Intronic
1152538915 17:80965108-80965130 AGCCCCGTGGATTAAGGCAGGGG - Exonic
1203165197 17_GL000205v2_random:87287-87309 AGCCCGGTGATGAAAGGTCTGGG + Intergenic
1158438721 18:57454448-57454470 AGCTCTGTGATGTCAGGCAGGGG + Intronic
1165469619 19:35995786-35995808 AGCCCCGTGATGGACGGCAAGGG + Exonic
1167323839 19:48812362-48812384 AGCCCCGGGCTGTAGGGTCGGGG + Intergenic
925647767 2:6054581-6054603 AGCTCCATGATGTACGGCAGAGG + Intergenic
938789746 2:134666175-134666197 AGCCCCATGGTGGAAGGTGGTGG - Intronic
1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG + Intronic
1176406554 21:6371804-6371826 AGCCCGGTGATGAAAGGTCTGGG - Intergenic
950149964 3:10679297-10679319 ATTCCTGTGATGTAAGGTATTGG - Intronic
953075172 3:39563050-39563072 AGCCCCGTGCTGGAAGAGAGTGG - Intergenic
957199055 3:77108618-77108640 ACCCTGGTGATGTAGGGTAGGGG + Intronic
957734046 3:84183053-84183075 AGCACCGTGATGTAAAGCACAGG + Intergenic
961444355 3:126972255-126972277 ACCCCCGTGATGGAGGGTGGGGG + Intergenic
970079981 4:12271366-12271388 AACCACCTGATGTCAGGTAGGGG - Intergenic
976855373 4:89598339-89598361 AGCCAGGTCCTGTAAGGTAGAGG - Intergenic
980194412 4:129569823-129569845 TGCCACGTGATGTCAGGAAGTGG - Intergenic
1012821006 6:104084423-104084445 AGCCTGTTGATTTAAGGTAGGGG - Intergenic
1019122395 6:169813660-169813682 AGCCAAGTGGTGGAAGGTAGAGG + Intergenic
1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG + Intergenic
1020217635 7:6206814-6206836 AGCCACAGGATATAAGGTAGAGG - Intronic
1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG + Intronic
1032632521 7:133669256-133669278 AGCCGCGGGATGTAAGGAAAAGG + Intronic
1036410879 8:8499244-8499266 GTCCCAGTGATGTAAGGAAGGGG - Intergenic
1041663263 8:60419650-60419672 AGCCCCGTGTTTAAAGGTAGGGG + Intergenic
1042411908 8:68475817-68475839 CTCCCTGTGATGTGAGGTAGTGG + Intronic
1042958965 8:74282211-74282233 ATCTCAGTGATTTAAGGTAGTGG - Intronic
1046668565 8:117033015-117033037 AGCCACGTGAAGGAAGGGAGTGG + Intronic
1052862747 9:33447037-33447059 AGCCCCCAGATGTAGGGGAGGGG - Intronic
1055349689 9:75373508-75373530 AGCCCAGTGATGTAAGATAATGG - Intergenic
1058362408 9:104164472-104164494 AGCCCCGTTGTCTAAGGTGGTGG - Intergenic
1187310049 X:18133185-18133207 AGCCCCTTGATTTAAAGTGGAGG + Intergenic
1195345267 X:103944100-103944122 TGCCCAGTGATGTCAGGTAGAGG - Intronic