ID: 1151458942

View in Genome Browser
Species Human (GRCh38)
Location 17:74243382-74243404
Sequence CAGGATAAAGAGCAGGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 571}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151458942_1151458950 9 Left 1151458942 17:74243382-74243404 CCTACCTCCTGCTCTTTATCCTG 0: 1
1: 0
2: 2
3: 42
4: 571
Right 1151458950 17:74243414-74243436 ATCTGCCTCATTGCCTGCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 235
1151458942_1151458949 8 Left 1151458942 17:74243382-74243404 CCTACCTCCTGCTCTTTATCCTG 0: 1
1: 0
2: 2
3: 42
4: 571
Right 1151458949 17:74243413-74243435 CATCTGCCTCATTGCCTGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 265
1151458942_1151458952 14 Left 1151458942 17:74243382-74243404 CCTACCTCCTGCTCTTTATCCTG 0: 1
1: 0
2: 2
3: 42
4: 571
Right 1151458952 17:74243419-74243441 CCTCATTGCCTGCCTGGGACTGG 0: 1
1: 0
2: 1
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151458942 Original CRISPR CAGGATAAAGAGCAGGAGGT AGG (reversed) Exonic
900191573 1:1354397-1354419 CAGGATGAAGAGCAGCAGCGTGG + Exonic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900409708 1:2507113-2507135 CAGGATGCCGAGGAGGAGGTGGG - Intergenic
901049691 1:6420001-6420023 CAGGAACAAAGGCAGGAGGTGGG - Intronic
901131037 1:6962691-6962713 CAGGATAAAAGGCAGGGAGTGGG - Intronic
901616159 1:10541434-10541456 CGGGAGAAAGAGCAGGAAGTGGG - Intronic
902461240 1:16578646-16578668 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902462022 1:16584942-16584964 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902462791 1:16591300-16591322 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903158750 1:21469422-21469444 CAGCATCAAGAGCAGGGAGTAGG + Intronic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905349665 1:37336657-37336679 GAGGATGAATACCAGGAGGTGGG + Intergenic
905706116 1:40059943-40059965 CAGGATACAGAACAGGAGTAAGG - Intronic
905707544 1:40072766-40072788 GAGGATTAAGAGCAAGAAGTTGG - Exonic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906593295 1:47048513-47048535 CAGGAGAAAGAGCAAGTTGTGGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906763282 1:48400583-48400605 GAGGAAATAGAGCTGGAGGTAGG - Intronic
906829037 1:49012371-49012393 CAGAATTATGAGCAGGTGGTTGG + Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908267466 1:62393551-62393573 CAGGATCCAGAGCAGAAGGAAGG - Intergenic
908329729 1:63059284-63059306 CAGTAGAAAGAGCATGAGTTTGG - Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908868892 1:68584862-68584884 CTTGATAAAGAGCAGGAGAAAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910149401 1:84124577-84124599 CAGCATAAAGAGGTGAAGGTAGG - Intronic
910209705 1:84780355-84780377 CAGAAGAAAGAACAGCAGGTTGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
913602686 1:120437222-120437244 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913603434 1:120443575-120443597 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913604178 1:120449924-120449946 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913640288 1:120806290-120806312 CAGCATCAAGAGCAGGGAGTAGG + Intronic
913641054 1:120812620-120812642 CAGCATCAAGAGCAGGGAGTAGG + Intronic
913990899 1:143610694-143610716 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
914084359 1:144439282-144439304 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914190369 1:145404557-145404579 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914212226 1:145590339-145590361 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
914277429 1:146137689-146137711 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914278189 1:146144048-146144070 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914363858 1:146960843-146960865 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914364612 1:146967198-146967220 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914365377 1:146973485-146973507 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914487071 1:148119954-148119976 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914487817 1:148126299-148126321 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914538477 1:148588637-148588659 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914539237 1:148594996-148595018 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914587405 1:149075110-149075132 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914588172 1:149081418-149081440 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914627443 1:149476632-149476654 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
914980606 1:152411317-152411339 CAGCACAAAGAGCAGCAGGTTGG + Intronic
915289817 1:154875984-154876006 CAGGACACAGAGCAAGAGGTGGG - Intergenic
915480458 1:156181027-156181049 GAGGAGAAAGAGGAGGGGGTTGG + Intergenic
915566639 1:156717672-156717694 CAGGCCAAATAGCTGGAGGTTGG - Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915603815 1:156938586-156938608 AAGGAGAGAGGGCAGGAGGTGGG + Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918631113 1:186719524-186719546 CAAGAGAGAGAGCAAGAGGTGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919950788 1:202361410-202361432 CAGGAGAAAGAGAGAGAGGTGGG + Intronic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920528902 1:206687222-206687244 CAGAATACAGAGCAGAAGTTGGG - Intronic
920612268 1:207453392-207453414 CAGAATAAAGAACTGGGGGTGGG + Intergenic
921151530 1:212406921-212406943 CAGGAGAAAGAAGAGGAGGGAGG - Intronic
921418807 1:214922250-214922272 CAAGACAAAGAAGAGGAGGTGGG - Intergenic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
921920920 1:220668160-220668182 CCCGACAAAGAGGAGGAGGTGGG + Intergenic
921963608 1:221063393-221063415 CAGGCTAAAGAGCAGTATGGAGG + Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
923119121 1:230974279-230974301 GAGGATAAAGAGCAGTGTGTAGG - Intronic
923427042 1:233881438-233881460 CAGGAAAAAGATCCAGAGGTAGG - Intergenic
1062997007 10:1875283-1875305 CAGTAAAAAGATCAGGAGTTGGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063447293 10:6127462-6127484 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447305 10:6127506-6127528 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447316 10:6127550-6127572 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447328 10:6127594-6127616 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063447351 10:6127682-6127704 CAGGAGACAGAAGAGGAGGTGGG + Intergenic
1063915687 10:10879753-10879775 AAGGATTAAGAACAGGATGTCGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064919731 10:20503510-20503532 CAACATGAAGAGCAGGATGTTGG + Intergenic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065541950 10:26779317-26779339 CAGGATAAGTACCAGGAAGTAGG + Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066365160 10:34769426-34769448 GAGGATAAATGGGAGGAGGTGGG - Intronic
1066425980 10:35308243-35308265 CACGCAAAAGAGGAGGAGGTGGG + Intronic
1066638998 10:37536814-37536836 CAGCATACTGAGCTGGAGGTGGG - Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1067993457 10:51242160-51242182 CAGGATAAAAGACAGGAGGCTGG + Intronic
1068129206 10:52876389-52876411 CAGCATGAATACCAGGAGGTAGG + Intergenic
1068262456 10:54600246-54600268 CAGGAGAAAGAGGAGAAAGTGGG + Intronic
1068639946 10:59392308-59392330 AAGGATTAAGAGCAGGAATTAGG + Intergenic
1068700702 10:60016706-60016728 AAGGATAAAGAAGAGTAGGTTGG - Intergenic
1069958257 10:72064505-72064527 CAGGATTCAGAAGAGGAGGTGGG + Intronic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070939408 10:80330037-80330059 CAGGATAAAGAGTAGTTAGTGGG - Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1075160369 10:120019216-120019238 CAGCATTCATAGCAGGAGGTGGG + Intergenic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077226047 11:1439583-1439605 CAGGAAAGAGCCCAGGAGGTGGG + Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077947774 11:6921117-6921139 AAGGATAAATAGCAGGATCTGGG - Exonic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1078849495 11:15151092-15151114 CAGGCTAAGGACCAGGAGTTGGG - Intronic
1079179974 11:18183364-18183386 GAGGAAAAAGAGTGGGAGGTAGG + Intronic
1080857296 11:36123385-36123407 CAGGAGAAAGAAAAGCAGGTAGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081587663 11:44398398-44398420 CAAGCCCAAGAGCAGGAGGTCGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082902826 11:58274393-58274415 CAAGATAAAGATGGGGAGGTTGG + Intergenic
1082986142 11:59172521-59172543 CAGGAGGAAGCGGAGGAGGTCGG + Exonic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1085232199 11:74981925-74981947 GAGGCTAAGGAGCAAGAGGTAGG + Intergenic
1085777276 11:79378295-79378317 CAGGATAAAGAGCCAGAGAAGGG - Intronic
1086031117 11:82356777-82356799 GGGGATGAAGAGCAGGAGGCAGG + Intergenic
1086331202 11:85756050-85756072 GAGGAGTAAGGGCAGGAGGTGGG - Intronic
1086478372 11:87204755-87204777 GAGGAGGAAGAGGAGGAGGTTGG + Intronic
1086598658 11:88606149-88606171 CAGCACAGAGAGTAGGAGGTAGG + Intronic
1087102701 11:94380671-94380693 CAGGATGTAGAGCAGGATGAAGG + Exonic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090959601 11:131544379-131544401 CTGGAGAAAGAAGAGGAGGTAGG - Intronic
1091764254 12:3107914-3107936 AAGTATAAATAGCACGAGGTTGG - Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094229096 12:28082438-28082460 CAGGAAAAAGAAAAGGAAGTAGG + Intergenic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1096828134 12:54294848-54294870 CGGGAGGGAGAGCAGGAGGTGGG + Intronic
1096875410 12:54626330-54626352 CAGGATATAAATGAGGAGGTGGG + Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097691011 12:62734739-62734761 TTCAATAAAGAGCAGGAGGTGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1102066342 12:109979242-109979264 CTGGTTAAAGAGCAGGAAATGGG - Intronic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102847675 12:116204720-116204742 TAGGATAAAGGGCAGGAGCCAGG - Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104753467 12:131254492-131254514 CAGGAGGAAGGGCAAGAGGTGGG - Intergenic
1105214388 13:18275840-18275862 CAGGATTCACAGCAGCAGGTGGG + Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1107588508 13:41879302-41879324 CAGCAGAAAGAGGAGGAGGGTGG - Intronic
1107708219 13:43127707-43127729 CAAGATAAAGGGCAGAAGCTGGG - Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1111961205 13:94812536-94812558 CAAGAGAAAGAGGAGGAGGGAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117881593 14:60318049-60318071 CAAGGTAAGGAGCAGAAGGTGGG - Intergenic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118893581 14:69928205-69928227 CAGGCTGGAAAGCAGGAGGTTGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119937248 14:78603202-78603224 CAGGAAAGAGAGCAGCAGGTGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122360335 14:101156247-101156269 CAGTATCAATAGCAGGGGGTAGG - Intergenic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1127211344 15:56777816-56777838 CAGGCTGAAGAGCATGGGGTGGG - Intronic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1129175604 15:73837763-73837785 CAGGATAGAGACCAGAAGGATGG + Intergenic
1129267274 15:74400489-74400511 CAGCAAAGAGAGCAGGAGCTTGG + Intergenic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1131274949 15:90973089-90973111 CAGGACAGAGGGCAAGAGGTAGG + Intronic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1136740526 16:32518850-32518872 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1137490212 16:48926109-48926131 AAGGCAAAAGAGCAGTAGGTAGG - Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138352365 16:56352783-56352805 CAAGGTGCAGAGCAGGAGGTGGG + Intronic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1139375773 16:66495457-66495479 AAGGATCAAGGGCAGGAGGGAGG - Intronic
1139375798 16:66495544-66495566 AAGGATCAAGGGCAGGAGGGAGG - Intronic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139469614 16:67171034-67171056 CAGGATAAAGGGCAGGACTTGGG + Intronic
1140492090 16:75346280-75346302 CAGTGTAAAGAGCACCAGGTAGG + Intronic
1140514161 16:75530241-75530263 GATGATGAAGAGCAGGAGGCAGG + Exonic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1203029080 16_KI270728v1_random:556384-556406 CAGGATAAAAACCAGAAGGAAGG + Intergenic
1203042641 16_KI270728v1_random:778047-778069 CAGGATAAAAACCAGAAGGAAGG - Intergenic
1142854261 17:2721268-2721290 CAGGACACAGAGCTGCAGGTGGG - Intergenic
1142883184 17:2896732-2896754 TAGGAAAAAGGGCAGGAGGCGGG - Intronic
1142984845 17:3689487-3689509 CAGGATATAGCCCTGGAGGTGGG - Exonic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143403446 17:6660472-6660494 CAGGCTAAGGAGCATGAAGTGGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144092210 17:11868245-11868267 CAGTTTAAAAAGCAGGTGGTGGG - Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147155470 17:38542541-38542563 CAGGAAAAAGATCTGGAGGTGGG + Intronic
1147967268 17:44199954-44199976 GAGGAGGAAGAGGAGGAGGTTGG - Intronic
1148134919 17:45286065-45286087 GAGGAAAAAGGGAAGGAGGTGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149450624 17:56747481-56747503 CAGGATAAAGAGTAGGTCTTGGG - Intergenic
1150107397 17:62472436-62472458 CAGGATAAAAGCCAGGAGGCTGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1151198796 17:72452607-72452629 CTGTTTAGAGAGCAGGAGGTGGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151509472 17:74549504-74549526 CAGGACCAGGAGCAGGACGTAGG + Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153800122 18:8661347-8661369 CAAGAAAAAGAGCAGGAGAGAGG + Intergenic
1154035482 18:10797793-10797815 CAGCATGAACACCAGGAGGTGGG - Intronic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1156469234 18:37367152-37367174 CAGGAGGAAGAGGAGGAGCTAGG + Intronic
1156688290 18:39675970-39675992 CAGGATGAAGAGAATGAGTTGGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1161075296 19:2282333-2282355 CTGGACAGAGACCAGGAGGTGGG + Intronic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1164273149 19:23691714-23691736 CAGGTGGAAGGGCAGGAGGTGGG - Intergenic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1168238319 19:55077042-55077064 CAGGATGAGGAACAGGAGTTTGG + Intronic
1168254012 19:55156374-55156396 CAGGATAAAGACCAGGCGTGGGG + Intronic
1168310980 19:55460826-55460848 AAGGCCAGAGAGCAGGAGGTCGG + Intronic
1202677676 1_KI270711v1_random:22386-22408 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926834427 2:17001935-17001957 CACGAGAAAGAGCTGGAGATGGG + Intergenic
927149852 2:20189237-20189259 CAGTATAAAGAACAGGTGGAGGG - Intergenic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927512446 2:23652841-23652863 CCTGATAAAAAGGAGGAGGTGGG - Intronic
927788680 2:25992723-25992745 GAGGATGGAGAGGAGGAGGTAGG - Intergenic
927803569 2:26123955-26123977 GAGGAGAAAGAGGAGGGGGTTGG - Intronic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
931829753 2:66038532-66038554 GAGGATGAAGAGCAGCAGGCTGG - Intergenic
932347027 2:71002162-71002184 GAGGATAAAGGGCAGGGGGTGGG + Intergenic
933408706 2:81897011-81897033 CAGGATAAATACCAGGATGTAGG - Intergenic
933438656 2:82281929-82281951 TTGCAGAAAGAGCAGGAGGTAGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934299935 2:91770899-91770921 CAGGATTCACAGCAGCAGGTGGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
936373853 2:111924548-111924570 GAGGAAGAAGAGCAGGAAGTGGG - Intronic
937214847 2:120305847-120305869 CATGAGACAGAGCAGGATGTTGG - Intergenic
937253875 2:120541222-120541244 AAGGACAAAGGGGAGGAGGTGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937884654 2:126891553-126891575 GAGGATAAAGAGCAGGGAGGAGG + Intergenic
938226436 2:129620255-129620277 CAGGATGAAGCACAGGAGTTGGG + Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938982549 2:136540275-136540297 CAGGAGAGAGAGCATGAAGTGGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940743306 2:157537779-157537801 AAGGAAAAAGAGTAGAAGGTGGG - Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941842800 2:170105867-170105889 AAGTATAAAGACCATGAGGTGGG + Intergenic
941962788 2:171270023-171270045 CAGGATGAAGTGCTGGGGGTGGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944612529 2:201426123-201426145 CAGGCTGCATAGCAGGAGGTGGG + Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946242910 2:218367786-218367808 CAGCAGGAAGAGCAGGAAGTCGG - Exonic
946882652 2:224191974-224191996 TAGTATAAAGACCAGGAGATTGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1170879549 20:20284038-20284060 AAGGATAAAAAGCATGTGGTAGG - Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1173447289 20:43130345-43130367 CAGAATAAAGTGCACCAGGTAGG + Intronic
1173525775 20:43731485-43731507 CAGGATGAAGATCAGCAGGGAGG - Intergenic
1173636927 20:44567734-44567756 CAGGATTAAGAACAGGAGCAGGG + Intronic
1173800845 20:45893405-45893427 CAGGTTTATGAGCAGCAGGTGGG + Intronic
1174102499 20:48138276-48138298 CAGGACAGAGAGCGGGAGGGAGG - Intergenic
1174130478 20:48340561-48340583 CAGGCTACAGAGCAGCAGGGAGG + Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174701357 20:52612384-52612406 CAGCATGAATACCAGGAGGTGGG - Intergenic
1175125560 20:56748844-56748866 AAGGATGAAGACCAGAAGGTGGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175199657 20:57268273-57268295 ATGGATGAAGAGCAGGTGGTGGG - Intergenic
1175243766 20:57568795-57568817 AAGGAAAAAGGGCAGGAGGGAGG - Intergenic
1175304165 20:57964631-57964653 GAGGAGACAGAGGAGGAGGTGGG + Intergenic
1176379051 21:6102562-6102584 CAGGATAACGAGCAGTTGGGCGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1179464606 21:41563241-41563263 GAGGATGAAGAACAGGAGGTGGG - Intergenic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180905183 22:19405504-19405526 CAGGACAAACAGCAGAACGTGGG + Intronic
1180946394 22:19696109-19696131 CAGGATACAGGGCAGCAGGGCGG + Intergenic
1180987145 22:19911726-19911748 CAGGATACAGGGCCTGAGGTGGG + Intronic
1181027530 22:20134483-20134505 CCAGATACAGGGCAGGAGGTGGG - Intronic
1181373133 22:22433714-22433736 CAGGAGAAAGGGTAGGAGGGGGG - Intergenic
1181556065 22:23672293-23672315 CAGGATTCACAGCAGCAGGTGGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181698284 22:24604995-24605017 CAGGATTCACAGCAGCAGGTGGG - Intronic
1181824852 22:25506867-25506889 CAGAATGAAGAGCCGGATGTAGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182323585 22:29494517-29494539 CAGCATGAATAACAGGAGGTGGG - Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1183277884 22:36912594-36912616 CAGGAGAAAGGGCAGCAGGCAGG - Intergenic
1184961994 22:47936677-47936699 CAGGATAAAAAGCAGGCAGCCGG - Intergenic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949541759 3:5038062-5038084 CTGGATACAGAGGAGGTGGTGGG + Intergenic
949559023 3:5186116-5186138 CAGGATCAAGGGCTGGAGCTGGG + Intergenic
949891578 3:8737408-8737430 AAGGATGAAGAGTAGGAGATAGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950486769 3:13278495-13278517 CAGCATGAAGGGCAGGTGGTGGG + Intergenic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
952062058 3:29522798-29522820 CAGGATACAGAGCATGAGACTGG + Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953367190 3:42354850-42354872 AAGGATGAAAAGGAGGAGGTGGG - Intergenic
953423683 3:42774484-42774506 CAGGATAAAGAGTAGGATTCAGG + Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954707935 3:52491013-52491035 CAGGGCTCAGAGCAGGAGGTAGG + Intronic
955579349 3:60402098-60402120 GATGATAAAGATCAGGAGGTAGG - Intronic
956086514 3:65616824-65616846 CAGGATAAAGAACTGGATGTTGG - Intronic
956169161 3:66419254-66419276 GAGGAGACAGAGGAGGAGGTGGG - Intronic
959490722 3:106985309-106985331 CAGGAGGAAGACCAGGAGCTGGG - Intergenic
960160323 3:114343536-114343558 GAGGAGAAAGAGGAGAAGGTGGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960764932 3:121115822-121115844 CAGGAGCAAGAGGAGGAGTTAGG + Intronic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961441871 3:126958166-126958188 TAGGATAGAGAGCAGCAGTTGGG - Intronic
962192403 3:133325323-133325345 CAAGAAAAAGGGCAGTAGGTGGG + Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964445420 3:156752696-156752718 GAGGAGGAAGAGGAGGAGGTGGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
965732085 3:171782981-171783003 CATGGTAAAGAGCAGGGGATGGG + Intronic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967182172 3:186915428-186915450 CATGCTAGAAAGCAGGAGGTGGG - Intergenic
967395339 3:189002245-189002267 GAGGAGACAAAGCAGGAGGTTGG - Intronic
967924717 3:194637207-194637229 CAGGAGAGTGAGCAGCAGGTGGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
969664641 4:8550025-8550047 CAGGAGACAGAGCAGGAAATGGG - Intergenic
970009150 4:11439491-11439513 GAGAATAAATACCAGGAGGTTGG + Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
974797379 4:66770353-66770375 GAGGGTAGAGGGCAGGAGGTGGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
976128558 4:81858984-81859006 AAGAAGAAAGAACAGGAGGTAGG + Intronic
977146184 4:93443122-93443144 TAGGAAAAAGAGCAGTAGCTTGG - Intronic
977428175 4:96896370-96896392 GAGGAGAAAGAGCAGGGAGTTGG + Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980666649 4:135948087-135948109 TAGGAAATAGAGGAGGAGGTGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
985515726 5:343751-343773 CACGAGGAGGAGCAGGAGGTGGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
990214220 5:53513199-53513221 CAGGATGTAGAGCATCAGGTGGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991029055 5:62063576-62063598 CAGTAGCAAGAACAGGAGGTAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
993977145 5:94496502-94496524 CTGGTTAAAAAGCAGGGGGTGGG + Intronic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994869812 5:105333365-105333387 CAAGATAGAGAGCAGAAGGATGG - Intergenic
995607843 5:113877123-113877145 CTGAATAGAGAACAGGAGGTAGG + Intergenic
995869114 5:116725744-116725766 CAGGATACAGTTCTGGAGGTTGG + Intergenic
996366262 5:122704132-122704154 CTAGATAAAGAGCAGTAGGATGG - Intergenic
996461012 5:123743096-123743118 CACGATAAAGATCAGGTGGCTGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
996979312 5:129471057-129471079 CAGGATCAAAATCAGGCGGTGGG + Intronic
997373858 5:133383177-133383199 CAGGAGGAAGTGCAGGATGTGGG - Intronic
997732628 5:136192342-136192364 CAGGAAGAAGAGCAGCAGGTAGG + Intergenic
998391282 5:141788536-141788558 TAGGAGAAAAAGGAGGAGGTGGG - Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999084183 5:148872642-148872664 AAGGAGAAAGAGCATGAGATCGG + Intergenic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001607568 5:172973229-172973251 CATGATCAAGAGCAGGAACTAGG + Intergenic
1002097320 5:176839216-176839238 CAGGACAAAGAGCATGTGCTAGG - Intronic
1002161367 5:177315600-177315622 CAGCATAATGATCAGGAGTTGGG + Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1004275244 6:14230297-14230319 GAGGATGAAGGGCAGGAGGGAGG - Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004447017 6:15709866-15709888 CAGGAAACAGAGCAAGAGGTGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006202950 6:32313086-32313108 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006203607 6:32319566-32319588 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1008632978 6:53381703-53381725 CAGGAGAAAGACCTGGAGGTGGG - Intergenic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009887442 6:69640612-69640634 CAAGATAAAGACCAGGAAGAGGG + Intergenic
1009973608 6:70650793-70650815 CAGGATAAAGCACAGGAGTCTGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010981003 6:82369458-82369480 AAGGAAAAAGAGTAGGAGCTTGG + Exonic
1011630237 6:89316090-89316112 GAGGACAGAGATCAGGAGGTGGG + Intergenic
1011817143 6:91205684-91205706 CAGGAGAAAGGGTGGGAGGTGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012762539 6:103320425-103320447 CAGGAGAGTGATCAGGAGGTGGG + Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015413739 6:132924470-132924492 TAGGATAAAGAACAAGACGTTGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015675330 6:135739888-135739910 TAGGATGAAGAGCAGAAGGAGGG + Intergenic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017006780 6:150033151-150033173 CGAGAGCAAGAGCAGGAGGTTGG + Intergenic
1018083153 6:160276237-160276259 CATGAGAAAGGACAGGAGGTAGG - Intronic
1018083429 6:160278398-160278420 CATGAGAAAGGACAGGAGGTAGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019795804 7:3047432-3047454 CAGAAAAAAGGACAGGAGGTTGG - Intergenic
1019942911 7:4305371-4305393 CAGGAGGAAGAGGAGGGGGTTGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021467001 7:20955459-20955481 TAGCAGAAAGAGCAGGAGTTTGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1022958386 7:35401988-35402010 GAAGAGAAAGAGCTGGAGGTGGG - Intergenic
1023026337 7:36053849-36053871 TAGGAGGAAGAGGAGGAGGTGGG - Intergenic
1023939809 7:44762131-44762153 CAGGGTGGAGAGCAGGACGTGGG + Intronic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1024991070 7:55234819-55234841 CAGGAGACAGAGGAGGGGGTTGG + Intronic
1025530414 7:61874267-61874289 CAGGATAAAAAACAGAAGGAAGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1027421805 7:78024156-78024178 TAGGATAAAAAGCAGGAGAATGG - Intronic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1028152597 7:87391312-87391334 GAGCATAAATAGCAGGAGGCAGG + Intronic
1028522312 7:91745791-91745813 TAGCATAAAGGGCAGGAGGAAGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1031469465 7:122151724-122151746 TAGGAGAAAGATCAGGAGTTTGG + Intergenic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1032036443 7:128524972-128524994 CAGGATAAAAGCCAGGAGGCCGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1033122342 7:138677198-138677220 TAAGAAAAAGAGCAGGAGGCCGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033820195 7:145125790-145125812 CAGGAGAGAGAGCACGAAGTGGG + Intergenic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1034713840 7:153220941-153220963 CAAGAAAAAAAGGAGGAGGTAGG - Intergenic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1034889010 7:154822775-154822797 CAGGATGAAGAGCAGGAAATAGG - Intronic
1034982318 7:155487092-155487114 CAGAATAAATAGCAGGCGTTGGG - Intronic
1035583848 8:757111-757133 GAGGAAAAACAGCACGAGGTGGG - Intergenic
1035953789 8:4053415-4053437 CATGATAAAAAGCAGGTGGTGGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036916649 8:12810753-12810775 GGGGAGAAAGAGGAGGAGGTAGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1038428601 8:27481754-27481776 CAGGAATTAGAGCAGGAGGCTGG - Intergenic
1038523535 8:28253897-28253919 CCGGACCAAGAGCAAGAGGTTGG + Intergenic
1039231517 8:35453927-35453949 TAGGAGAAATAGCAGGGGGTAGG - Intronic
1041315529 8:56558108-56558130 AAGGAGATAGAGCAGGAGGGCGG - Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1042661590 8:71160551-71160573 CAAGATAGAGAGCTGGAGCTGGG - Intergenic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1044416460 8:91945581-91945603 CAGGCTGCAAAGCAGGAGGTAGG - Intergenic
1045555194 8:103208759-103208781 CAGGATCAAGAGCAGGCAGCAGG - Intronic
1045799517 8:106086502-106086524 GGGGATAATGAGCAGAAGGTTGG - Intergenic
1046475469 8:114736953-114736975 CAGGAGAAAGGGCGGGAGGCAGG - Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1048808607 8:138264128-138264150 AAGGACAAAGAGCCTGAGGTGGG - Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049530824 8:143153976-143153998 CACGATACAGAGCGGGAGGGAGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1055323270 9:75102677-75102699 CAGAATAAAGAGCAGGGTCTGGG - Intronic
1055407542 9:75990226-75990248 CAGGCTAACGAGCTGGAGGCAGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057936781 9:99246668-99246690 CAGGAAAAAGAGGAAGAGGTTGG + Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058234836 9:102476964-102476986 CAGGGTACAGAGCAGGGAGTGGG - Intergenic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059913730 9:119075764-119075786 AAAAAAAAAGAGCAGGAGGTGGG - Intergenic
1060016201 9:120088423-120088445 CAGGACACAGAGCAGTAGGGAGG + Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062655574 9:137603066-137603088 TAGGATATAGGGCAGGAGGCTGG + Intergenic
1203441179 Un_GL000219v1:9995-10017 CATGATCAAGAGCAGTAGATAGG + Intergenic
1203511988 Un_KI270741v1:128903-128925 CATGATCAAGAGCAGTAGATAGG + Intergenic
1185667090 X:1774507-1774529 CGGGCCACAGAGCAGGAGGTGGG - Intergenic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188029313 X:25246932-25246954 CGGGAAAATGACCAGGAGGTGGG + Intergenic
1188475732 X:30589665-30589687 CAGGAGAGAAAGCAAGAGGTGGG + Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1189449641 X:41116937-41116959 CAAGATAAAGAGCAGGAAATAGG - Intronic
1189613062 X:42757133-42757155 GAGGATAAAAAGCAGGACATAGG - Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193112771 X:77746143-77746165 AAGGTGAGAGAGCAGGAGGTGGG + Intronic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1195783610 X:108491653-108491675 CAAGCTAGAGAGCAGGGGGTGGG - Intronic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1198370644 X:135985717-135985739 CAGGATGAAGATGAGCAGGTTGG - Exonic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198875153 X:141216742-141216764 CAGGACAAAGGGAAGGTGGTTGG + Intergenic
1199606337 X:149582565-149582587 CAGGACAATGATCAGGAGGGCGG + Exonic
1199632785 X:149786803-149786825 CAGGACAATGATCAGGAGGGCGG - Exonic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic