ID: 1151459257

View in Genome Browser
Species Human (GRCh38)
Location 17:74245080-74245102
Sequence TCGTCCAGTGACTTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151459250_1151459257 -5 Left 1151459250 17:74245062-74245084 CCTAACCACACTCACACCTCGTC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 95
1151459251_1151459257 -10 Left 1151459251 17:74245067-74245089 CCACACTCACACCTCGTCCAGTG 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 95
1151459249_1151459257 -4 Left 1151459249 17:74245061-74245083 CCCTAACCACACTCACACCTCGT 0: 1
1: 0
2: 0
3: 2
4: 114
Right 1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151459257 Original CRISPR TCGTCCAGTGACTTGGGGGC TGG Intronic
901399428 1:9005900-9005922 CAGCCCAGTGACTTGGGGCCCGG + Intronic
903238090 1:21963756-21963778 TCGATGAGTGATTTGGGGGCAGG - Intergenic
903601766 1:24547170-24547192 TCCTCCAGTCTCTTGGGGGGGGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
907247301 1:53116338-53116360 CAGTCCAGTGAGGTGGGGGCAGG - Intronic
912797832 1:112703583-112703605 TCATTCAGTGACTGGGGGGCGGG + Intronic
915470855 1:156124989-156125011 TCCTCAGGTGACCTGGGGGCAGG + Intronic
919451147 1:197774978-197775000 CCGGCCAGAGGCTTGGGGGCCGG + Intronic
919830623 1:201538409-201538431 TCTTCCAGGGACTTGGGAGTGGG - Intergenic
920542143 1:206786875-206786897 TTCTCCGGTGGCTTGGGGGCTGG - Intergenic
1063639578 10:7816709-7816731 TCCTCCTGGGACTTGGGGGAAGG - Intergenic
1065047449 10:21757193-21757215 TCTGCCAGTGTCCTGGGGGCTGG - Intronic
1065588231 10:27240822-27240844 TCCTCCGGTGACTCTGGGGCGGG - Intronic
1069020689 10:63484956-63484978 TCCTCCAGTGAATTAGGGGAGGG - Intergenic
1072732290 10:97854347-97854369 TGGCCCACTGACCTGGGGGCAGG - Intronic
1074898627 10:117797875-117797897 TAGCCCACTGACTTGGGGGCAGG - Intergenic
1076560474 10:131360097-131360119 CAGTCCAGTGGGTTGGGGGCAGG - Intergenic
1077299376 11:1840112-1840134 TCGGCCGGTGAGGTGGGGGCGGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1084597102 11:70123459-70123481 TCCTCCAGTGCCTGGAGGGCAGG - Intronic
1089356396 11:117856852-117856874 TCATCCAGTTATTTAGGGGCAGG + Intronic
1091686566 12:2566815-2566837 TCCAACAGTGACTTTGGGGCAGG - Intronic
1092885740 12:12923112-12923134 TTGGCCAGGGCCTTGGGGGCGGG - Intergenic
1097961310 12:65534314-65534336 TATTCCAGTTACTTGGGGGAGGG - Intergenic
1102394649 12:112575486-112575508 GCGACGAGGGACTTGGGGGCGGG + Intronic
1102822351 12:115918466-115918488 TCAATCAGTGACTTGGGAGCTGG - Intergenic
1104760242 12:131293805-131293827 GCGCCCAGCGACTAGGGGGCTGG - Intergenic
1104819528 12:131666841-131666863 GCGCCCAGCGACTAGGGGGCTGG + Intergenic
1106932714 13:34684229-34684251 TAGACCAGTGGCTTGGGGGAAGG - Intergenic
1107451519 13:40514510-40514532 CCTGACAGTGACTTGGGGGCAGG - Intergenic
1107673242 13:42768530-42768552 TGGTTCATTGATTTGGGGGCTGG - Intergenic
1110383399 13:74879847-74879869 TCTTCAAGTGAATGGGGGGCAGG - Intergenic
1112495048 13:99897485-99897507 TTGTCCTGTGACTTAGGTGCGGG - Intergenic
1115475277 14:33807527-33807549 TCTGCCAGTGACATGGTGGCAGG + Intergenic
1116249186 14:42458626-42458648 TCATCCAGCTACTTGGTGGCAGG + Intergenic
1123023636 14:105413457-105413479 TTGTTCTGTGACTTGGGGGTTGG + Exonic
1124385599 15:29206037-29206059 TCGTCCTGTGTCATTGGGGCTGG - Intronic
1126758718 15:51949715-51949737 AAGTCCAGTGACTTGGCAGCCGG + Intronic
1128344929 15:66847746-66847768 TGGGGCAGTGACTTTGGGGCAGG - Intergenic
1129700210 15:77763412-77763434 TGGTCCAGTGACTGGGGAGAGGG - Intronic
1132949443 16:2552616-2552638 TCTTCCAGGGACTTGGGGGATGG + Intronic
1132964905 16:2647550-2647572 TCTTCCAGGGACTTGGGGGATGG - Intergenic
1133228459 16:4354734-4354756 TGGTCAAGGGCCTTGGGGGCTGG - Exonic
1136221947 16:28834750-28834772 TTCTCCAGAGACTTGGGAGCTGG + Intronic
1137410988 16:48227938-48227960 TTGTCCAGGGGCTGGGGGGCAGG + Exonic
1137777487 16:51068422-51068444 TTATCCAGAGACATGGGGGCAGG - Intergenic
1137833695 16:51569897-51569919 TATTCCAGTGACTTTGGGGGAGG - Intergenic
1139782664 16:69364673-69364695 TCGTCGAGTGTGTTGGGGGCTGG - Intronic
1140223409 16:73059733-73059755 TCGTCCTCTGATTTGGGGGGAGG - Intergenic
1142106331 16:88304979-88305001 TCATCCAGTGGCTTGGGGAGGGG - Intergenic
1142689301 17:1595396-1595418 TGTCCCAGTGACTTGGGAGCTGG - Intronic
1143383124 17:6508646-6508668 GCGTCCAGAGGCTTGGGGACTGG + Intronic
1149211367 17:54305660-54305682 GTATCCAGTGACTTGGGGGTTGG - Intergenic
1151459257 17:74245080-74245102 TCGTCCAGTGACTTGGGGGCTGG + Intronic
1152582232 17:81171185-81171207 GGGGCCAGTGACCTGGGGGCAGG + Intergenic
1155251431 18:23956886-23956908 TCGTTCAGTGGATTGGGGACTGG + Intergenic
1157862301 18:51152238-51152260 TGCTCCACTGCCTTGGGGGCAGG - Intergenic
1160981896 19:1820047-1820069 TCGTTCAGTGCCTGGGGGACAGG + Exonic
1162173661 19:8813064-8813086 CTGGCCAGTGACTTGGGGGTTGG - Intronic
1162209907 19:9083042-9083064 TCTCCCAGTGCCTTGGGGTCAGG + Intergenic
1162597345 19:11639667-11639689 TCGCTCAGTGCCTAGGGGGCGGG + Intergenic
1164806519 19:31121256-31121278 GCGTCCAGGGAATTGGGGGGAGG - Intergenic
1165951800 19:39478032-39478054 TCATCCAATGACTTGGGGGCAGG + Intergenic
1166768201 19:45264990-45265012 CTGTCCAGCGACCTGGGGGCGGG + Intronic
930046352 2:47176220-47176242 TCCTCTAGTGAGTTGAGGGCCGG - Intronic
936360642 2:111797849-111797871 TCCTCCAGTGTCTTGAGGTCAGG - Intronic
937183263 2:120014636-120014658 TAGTCCAGTGAAATGGGAGCGGG + Intronic
939069224 2:137518875-137518897 TCGGCCAGCTACTTGGTGGCAGG + Intronic
1174492669 20:50912560-50912582 TCGTGGAGGTACTTGGGGGCAGG - Intronic
1175442627 20:59002168-59002190 TCCCCCAGTGCCTTCGGGGCTGG - Intronic
1181601940 22:23958041-23958063 TGGTCCATTCACTTAGGGGCTGG - Intronic
1181606569 22:23983266-23983288 TGGTCCATTCACTTAGGGGCTGG + Intronic
1185062951 22:48616556-48616578 TCGTGCTGTGACTTGCAGGCAGG - Intronic
956644452 3:71442509-71442531 TCGCGCAGTGAGTTGGGTGCTGG + Intronic
960909271 3:122632703-122632725 TCGTCCAGTAACTGCGGGACAGG - Intronic
965194048 3:165571927-165571949 TTTTCCAGGGACTTGGGGGAAGG + Intergenic
965559749 3:170049850-170049872 TCTTCCAGTGGCTTGGGAGCTGG + Intronic
967726768 3:192869489-192869511 TGTTCCAGTGATTTGGGGACAGG - Intronic
968395537 4:233273-233295 TAGTCCAGTGGCCTGGGGGAAGG + Intergenic
979360868 4:119763475-119763497 TGGTTCAGAGACTTGAGGGCAGG + Intergenic
991271036 5:64781538-64781560 GCATCCAGTGAGTAGGGGGCAGG - Intronic
994897698 5:105726272-105726294 TCTTCCAGTCCCTTGGGGTCAGG + Intergenic
996543469 5:124653672-124653694 TGGTCCAGTCAGATGGGGGCAGG - Intronic
999116753 5:149170772-149170794 TCGTCCGTTGATTTGGGGGGAGG + Intronic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1013092390 6:106911992-106912014 TCATTCAGTTACTTGGGGGGGGG + Intergenic
1015646175 6:135391310-135391332 TTTTCCATGGACTTGGGGGCAGG + Intronic
1015867851 6:137745270-137745292 TTATCCAGTGAGTTGGGAGCAGG - Intergenic
1019493061 7:1324005-1324027 CCGTCCAGTGCCCTGGGGCCAGG + Intergenic
1020000449 7:4752741-4752763 ACGTCCAGTGGCTTTGGGTCTGG + Intronic
1021555001 7:21910085-21910107 CAGTCCATAGACTTGGGGGCAGG + Intronic
1026126838 7:67586759-67586781 TCATCCAGTGGTGTGGGGGCTGG + Intergenic
1034344410 7:150377559-150377581 TCGTGCATTGAATGGGGGGCTGG + Intronic
1035243038 7:157544534-157544556 CCGTCCAGTGAGGAGGGGGCGGG + Intronic
1036171966 8:6495984-6496006 TTTTCCAGGGACTTGGGGGTTGG + Intronic
1038443213 8:27585965-27585987 TCTTGCAGTGCCTTGTGGGCTGG + Intergenic
1048259997 8:132937176-132937198 TCGACCTGGGACTTGGGGGTTGG + Intronic
1049235757 8:141511452-141511474 TTGACCCGTGATTTGGGGGCGGG + Intergenic
1052528235 9:29649522-29649544 TTGGCCTGTGACTTGGGGGCAGG + Intergenic
1052668806 9:31528812-31528834 TAGACCAGGGATTTGGGGGCTGG + Intergenic
1055134250 9:72808816-72808838 TCATCCAGAGACTAGAGGGCAGG - Intronic
1056430878 9:86526705-86526727 TTGGACAGTGACTTGAGGGCTGG + Intergenic
1056528462 9:87465978-87466000 CCGTCCAGTGAGCTGGGGGCAGG - Intergenic
1062481154 9:136753021-136753043 ACGTCCAGTGACTTTTGGGCAGG + Intergenic
1188612820 X:32120327-32120349 TGGTCCAGTAACTTTGGTGCAGG - Intronic
1188613003 X:32122290-32122312 TGGTCCAGTAACTTTGGTGCAGG - Intronic
1196888103 X:120266334-120266356 TAGTCTAGGGACTTGGGGGTGGG - Intronic