ID: 1151459396

View in Genome Browser
Species Human (GRCh38)
Location 17:74245719-74245741
Sequence CTGCATTTTAATAGGAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151459396 Original CRISPR CTGCATTTTAATAGGAAGCC GGG Intronic
902890894 1:19442768-19442790 CGGCATCTTTACAGGAAGCCAGG - Intronic
903429320 1:23280579-23280601 CTGCATTTTAACAAGATCCCTGG + Intergenic
903781832 1:25825152-25825174 CTGCATTTAGATAGGAAACCTGG - Intronic
907576857 1:55534532-55534554 CTGCATTTAAATCAGAAGCTGGG - Intergenic
907827407 1:58032165-58032187 CTGCATTTTAACAAGACGCCAGG + Intronic
907952318 1:59195726-59195748 CTACATTTTGATGGGAAGGCAGG + Intergenic
908404043 1:63796425-63796447 CTGCATTTTAACATGATCCCAGG + Intronic
909946687 1:81671451-81671473 CTGCATTTTAACAAGATCCCTGG - Intronic
910054587 1:83017128-83017150 TTGCATTATAAGATGAAGCCTGG + Intergenic
910728811 1:90368021-90368043 CTGCATTTGAACAAGAATCCTGG - Intergenic
910872568 1:91848351-91848373 CTGCATTTTAACAAGATCCCTGG + Intronic
911405670 1:97435259-97435281 ATCCATTTTAATAGGAGGCAGGG - Intronic
911847202 1:102769149-102769171 CTGCCTCACAATAGGAAGCCAGG + Intergenic
912959171 1:114180240-114180262 CTGCATTTTAAAAAGATCCCTGG + Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
916589106 1:166173305-166173327 CTGCATTTTAACAAGATTCCCGG - Intergenic
916754146 1:167752591-167752613 CAGCATCTCAATAGGAAGCAGGG + Intronic
917680727 1:177364195-177364217 CTACATTTTAAGAGGAAACTAGG + Intergenic
917924364 1:179776620-179776642 CTTCATTTCCATAGGATGCCAGG + Intronic
918373342 1:183883119-183883141 CTGCTTTTTATTCGGAATCCTGG + Intronic
919003507 1:191865347-191865369 CTGTATTATAATTTGAAGCCAGG - Intergenic
919030565 1:192236948-192236970 CTACATTTTAATAGACAACCTGG - Intergenic
919287970 1:195589695-195589717 CTGTATTTTAATTTGAAGTCAGG - Intergenic
920033923 1:203053573-203053595 CTGCATTTTAACAAGACCCCTGG - Intronic
920231892 1:204476132-204476154 TTGAATTTTTAGAGGAAGCCAGG - Intronic
920280538 1:204840097-204840119 CTGCATTTTAACAAGATCCCAGG - Intronic
920356675 1:205378431-205378453 CTGCATTTCAACAGGATCCCAGG - Intergenic
920762387 1:208797901-208797923 CTGCATTTTAACAAGATACCGGG - Intergenic
921912314 1:220562996-220563018 CTGCATTTAAGTAGGTAGCTTGG + Intronic
922957746 1:229618667-229618689 CAGCATCTTAAGAGGATGCCTGG - Intronic
923072640 1:230579740-230579762 CTGCATTTTAACAGGACACCAGG + Intergenic
924190899 1:241551846-241551868 CTGCATTTTAACAGGATCCCGGG - Intronic
924262234 1:242243836-242243858 CTGCTTTTTAATTGGAAACACGG + Intronic
924826766 1:247547817-247547839 CTGCATTTTAACAGGATCCTCGG + Intronic
1063961199 10:11306844-11306866 CAGTTTTTAAATAGGAAGCCAGG + Intronic
1064465116 10:15571647-15571669 CTGCATTTTAACAGACAGCCAGG + Intronic
1065874397 10:29984244-29984266 CTGCATTTTCATAAGATACCTGG - Intergenic
1066672472 10:37854989-37855011 CTGCATGTTAAAAAGATGCCAGG + Intronic
1066714189 10:38268757-38268779 ATGCATTTTAATAAGCACCCAGG - Intergenic
1068250437 10:54432314-54432336 CTGCAGTGTAATTTGAAGCCAGG - Intronic
1068561320 10:58517689-58517711 CTACATTTTAATAGGGAGCTTGG + Intronic
1069313795 10:67072660-67072682 CTGGATTTTGATTGAAAGCCTGG + Intronic
1069366425 10:67699014-67699036 TTGCATTTTAATAGGAGGGAGGG - Intergenic
1069504287 10:68983500-68983522 GTACATTTTAATAGAAAGCCAGG + Exonic
1069529767 10:69208274-69208296 CTGCATTTTAACAAGATCCCTGG + Intronic
1070296610 10:75166913-75166935 CTGCATTTTAACAAGCACCCAGG - Intronic
1071040429 10:81302288-81302310 ATGCATTTAAATAGGAAGAGAGG + Intergenic
1071866206 10:89735014-89735036 CTGCATTTTAATAAGGTCCCTGG + Intronic
1072878105 10:99195943-99195965 CTGCAGTATAATATGAAGTCAGG - Intronic
1074470836 10:113725278-113725300 CAGCATTTTCAGAGGCAGCCTGG - Intronic
1074979257 10:118606514-118606536 CTGCATTTTAACAAGATCCCAGG + Intergenic
1076253088 10:128998182-128998204 CTGTCTTTTAAGAAGAAGCCAGG - Intergenic
1078597337 11:12698759-12698781 CTGCATTTTAATAAAATTCCAGG + Intronic
1079057083 11:17215641-17215663 TTTCATTATAATAGGAAGCAGGG - Intronic
1079220933 11:18560701-18560723 CTGCATTTTAATAAAATCCCTGG - Intronic
1080563934 11:33490809-33490831 CTGCATTTTGATAAGATCCCAGG - Intergenic
1080601422 11:33824009-33824031 CTGCAGTATAATATGAAGTCAGG + Intergenic
1080785173 11:35468777-35468799 CTGCATTTTACAAGGCATCCTGG + Intronic
1081373264 11:42329848-42329870 CTGCAGGCTAAAAGGAAGCCTGG - Intergenic
1083473300 11:62898823-62898845 CTGCATTTTAATGAGATCCCAGG + Intergenic
1084701043 11:70786244-70786266 CTCCATTGTAAAAGGAGGCCAGG - Intronic
1084842926 11:71872190-71872212 CTACATTTTAATCTGAAGACTGG - Intronic
1087496869 11:98902546-98902568 AGGTATTTGAATAGGAAGCCAGG - Intergenic
1087971127 11:104485600-104485622 TTGCATTCTAATAGCAACCCTGG + Intergenic
1088355428 11:108938666-108938688 CTGCATTTTAAAAGAGTGCCTGG - Intronic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1089584395 11:119501207-119501229 CTGCATTTTGATAGGAAGGCTGG - Intergenic
1089824643 11:121264357-121264379 CTGCAGTATAATAGAATGCCAGG - Intergenic
1089950049 11:122517232-122517254 TTGCATTATAATAAGAAACCTGG + Intergenic
1090263656 11:125340749-125340771 TTACATTTTAAGAGCAAGCCAGG + Intronic
1090478379 11:127045822-127045844 CTCCATTTTATAAGGAAGGCTGG - Intergenic
1090623383 11:128583035-128583057 CTGCATTGTAACAGGATCCCCGG - Intronic
1091107384 11:132935581-132935603 CAGCACTTTCATGGGAAGCCAGG + Intronic
1094303373 12:28991036-28991058 CTGCATTTTAGCATGAGGCCTGG + Intergenic
1095266531 12:40165412-40165434 CTGTATTTTAATAAGAACCTTGG + Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1098565180 12:71926946-71926968 CTGCATTTTAACAAGCATCCAGG + Exonic
1098638723 12:72815180-72815202 CTGGATTTTAACAGGAAGTGGGG + Intergenic
1099792096 12:87349183-87349205 TTGCATTTTAACAGGAAGTGTGG + Intergenic
1099834971 12:87897807-87897829 CTCCATTTAAATAGCAAGGCAGG + Intergenic
1099932862 12:89093463-89093485 CTGCATTTTAACAAGAACCCTGG + Intergenic
1101007719 12:100417610-100417632 CTGCCTTTTAAGAGTAAGTCAGG + Intronic
1101097501 12:101357922-101357944 CTGCATTTTCATATGATCCCTGG + Intronic
1101250911 12:102934330-102934352 CTGTATTATAATTTGAAGCCAGG + Intronic
1101725253 12:107383335-107383357 CCGCATTTTGAGAGGCAGCCTGG + Intronic
1101747503 12:107554665-107554687 CTGCATTTTAAGAAGATCCCAGG - Intronic
1101749881 12:107574786-107574808 CTGCATTTTAACAAGATCCCAGG + Intronic
1102620279 12:114189136-114189158 CTGCATTTTAATAAGTACCTGGG - Intergenic
1103246149 12:119459250-119459272 CTGCATTTTAACAGGATCCTCGG - Intronic
1104558268 12:129821720-129821742 CTGCATTTTAAGAAGATCCCAGG - Intronic
1105707023 13:22974134-22974156 CTGTTATTAAATAGGAAGCCAGG + Intergenic
1105721338 13:23117947-23117969 CTGCATATTAACAGGAGGCCAGG + Intergenic
1107675123 13:42788118-42788140 CTGCATTTTAATAAGGTACCTGG - Intronic
1107825680 13:44327085-44327107 CTGCATTTTCACAGGATCCCAGG - Intergenic
1107996963 13:45870619-45870641 CTGCATTTAAATCTGAAGCAGGG - Intergenic
1108168853 13:47720697-47720719 CTGCATTTTAACAAGAGACCAGG - Intergenic
1108426785 13:50310371-50310393 CTGCTTTTTAGTAGGAAACCTGG + Intronic
1109635544 13:65110185-65110207 CTGCAGCTTTATAGGAAGGCTGG + Intergenic
1109898242 13:68723796-68723818 ATGTATCTTAATATGAAGCCGGG - Intergenic
1111402871 13:87763888-87763910 CTGCATTTTAACAAGATCCCTGG - Intergenic
1111963418 13:94835647-94835669 CTGCCTTTTAAGAGAAGGCCTGG + Intergenic
1112074864 13:95901536-95901558 CTGCATTTTAATAAGATACCAGG - Intronic
1112195216 13:97219148-97219170 CTGCATTTTAACAAGACCCCTGG + Intergenic
1113522692 13:110951861-110951883 CTGCATTTTAAAATAAAGCATGG - Intergenic
1114434827 14:22697243-22697265 CTCTATTTTAATAAGAACCCTGG - Intergenic
1114884117 14:26826317-26826339 CTGCATTTTAGTATTATGCCAGG - Intergenic
1115414890 14:33120712-33120734 CTGCATTTTGACAAGATGCCCGG + Intronic
1116265105 14:42677901-42677923 CTGGATTTTGATATGAAGTCTGG + Intergenic
1117821133 14:59650433-59650455 ATGCATTGAAATAGGAAGACAGG + Intronic
1118863706 14:69685549-69685571 CTGCATTTTACTAAGAGACCAGG - Intronic
1119044665 14:71308031-71308053 CTATATTTTAATAGGTACCCCGG + Intergenic
1119238553 14:73040024-73040046 ATGCATTTTAGCAGGAATCCTGG - Intergenic
1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG + Intronic
1123778657 15:23604509-23604531 TTGCCTTTTTATAGGAGGCCTGG + Intronic
1126349238 15:47727458-47727480 CTGCATTTTAGCAAGATGCCAGG - Intronic
1126462917 15:48932344-48932366 CTGCATTTTAATAAGCAATCAGG + Intronic
1126891927 15:53215649-53215671 CTGCAGTTTTATGGGAAGCCAGG + Intergenic
1127596553 15:60488069-60488091 CTGCCTTTTTATAGGATCCCAGG - Intergenic
1127856542 15:62958258-62958280 CTGCATTTTAACAAGATCCCAGG - Intergenic
1128618571 15:69129787-69129809 GTGCATTTTAACAGGAATCCAGG + Intergenic
1129077598 15:73010595-73010617 TGGCATTTTAATGGGAAGGCAGG - Intergenic
1129798827 15:78398105-78398127 CTGCAGTTTAACAGGATCCCTGG + Intergenic
1130918089 15:88321728-88321750 CTGCATTTTAATAGGATCCCAGG - Intergenic
1131761355 15:95626373-95626395 CTGCATTTTAGTAAGACCCCAGG + Intergenic
1131995566 15:98129612-98129634 CTGCATTTTAATAGGCAGGTGGG + Intergenic
1132410398 15:101573656-101573678 CTGCATTTGAATAGCAAGCCTGG + Intergenic
1133146176 16:3788300-3788322 CTGCATTTTTATAAAAATCCTGG - Intronic
1133149397 16:3816213-3816235 ATGCTTTTTAATGGGAAACCTGG - Intronic
1134098376 16:11434699-11434721 CTGCATTTGAATTCCAAGCCAGG - Intronic
1134208900 16:12259695-12259717 CTGCATTTTAATAACTATCCAGG - Intronic
1135115957 16:19723643-19723665 CTGCATTTTAACATGTATCCAGG - Intronic
1135904056 16:26494241-26494263 GTGCATTTTAATAAGAAAACAGG - Intergenic
1138465167 16:57185164-57185186 CTGCATTTTAAAAGGGCCCCAGG + Intronic
1139974532 16:70798679-70798701 CTGCATTTTAACAAGATCCCTGG - Intronic
1140594379 16:76391846-76391868 CTGCATTTTAATACGATCCCTGG + Intronic
1140818416 16:78641333-78641355 CTTCTTTTTAATTAGAAGCCTGG + Intronic
1140972584 16:80027866-80027888 CTGCATTTTAACAGGATCCCGGG - Intergenic
1140999799 16:80297645-80297667 CTGCATTTTAATAAAAACCCAGG + Intergenic
1142880211 17:2878072-2878094 CTGCATTTCCAGAGGATGCCAGG - Intronic
1143382443 17:6504713-6504735 CTGCATTATAATTGGATACCTGG + Intronic
1143599470 17:7934744-7934766 CTGCAGGTTAAGAGAAAGCCAGG - Intronic
1144390594 17:14790067-14790089 CTGCATTTTAACAAGCAGCCCGG - Intergenic
1144611730 17:16725154-16725176 CTTTTTTTTAATAGGAAGCATGG + Intronic
1146685600 17:34839560-34839582 CTGCATTTTATCAGGACCCCTGG - Intergenic
1147305106 17:39557913-39557935 CTGCATTTTACAAGGAAACTAGG - Intronic
1147667418 17:42157352-42157374 CTGCGTTTTAATAGGATCTCAGG + Intronic
1148701853 17:49592310-49592332 CTGCATTTTAATAAGATCTCTGG - Intergenic
1149231101 17:54535745-54535767 CTGGATTTTAAGAGGAAGGGAGG - Intergenic
1150230375 17:63546382-63546404 CTCCATTTAAACAGCAAGCCTGG + Exonic
1151269999 17:72986658-72986680 CTGCATTTTAACAGGCTCCCGGG + Intronic
1151422603 17:74008300-74008322 CTGCATTTTAACAGGATGTGCGG + Intergenic
1151459396 17:74245719-74245741 CTGCATTTTAATAGGAAGCCGGG + Intronic
1152969970 18:152335-152357 CTGCATTTTAACAAGATCCCAGG + Intergenic
1154029043 18:10734414-10734436 CTGCATTTAAATAAGACCCCAGG + Intronic
1154085492 18:11301127-11301149 CTGCAGTATAATTGGAAGTCAGG + Intergenic
1154121671 18:11657461-11657483 CTGCCTTTTGATAGGAAGAAAGG - Intergenic
1155008073 18:21747361-21747383 CTGCATTTTAAAAGGTCCCCAGG - Intronic
1155396551 18:25392476-25392498 TTGCATTTTCATAGAAAGCAAGG - Intergenic
1158545188 18:58390124-58390146 CTGCATTATTATGGGAATCCAGG - Intronic
1158623128 18:59049747-59049769 CTGCATTTTAACAAGCACCCTGG + Intergenic
1163172111 19:15538875-15538897 TTCCATTTTAGTAGGAAGACAGG + Intronic
1166102803 19:40581106-40581128 GTGGATTTTTCTAGGAAGCCAGG - Intronic
1167883979 19:52485319-52485341 CTGCACTCTAATGTGAAGCCAGG - Intronic
1167888096 19:52518402-52518424 CTGCACTCTAATGTGAAGCCAGG - Intergenic
1167916361 19:52743209-52743231 CTGCACTCTAATGTGAAGCCAGG + Intergenic
1167963113 19:53123222-53123244 CAGCACTTTCATATGAAGCCAGG + Intronic
925259895 2:2520179-2520201 CTGCATTTTGATAAGATCCCAGG + Intergenic
925445241 2:3921448-3921470 CTCCATTTTCCTAGGAAACCAGG - Intergenic
925623751 2:5821135-5821157 CTGAATTTTGGTAGGAGGCCAGG - Intergenic
925677745 2:6383441-6383463 CTGCATTCTAGAATGAAGCCCGG - Intergenic
926382467 2:12304053-12304075 CTGTATTTTAATATTAATCCTGG - Intergenic
926444736 2:12928480-12928502 GTGCATTATCTTAGGAAGCCAGG + Intergenic
926970045 2:18457638-18457660 CTGCATTTTAATAAGATCCCTGG - Intergenic
927169136 2:20353697-20353719 CTGCATTTTAACAAGATTCCCGG + Intergenic
928069499 2:28200526-28200548 GTGCATATTAGTAGGCAGCCTGG + Intronic
929318000 2:40504040-40504062 CTGCATTATAATTTGAAGCCAGG - Intronic
929833214 2:45367057-45367079 CAGCATCTTAACAGGAAGCCTGG - Intergenic
930044879 2:47161463-47161485 CAGCATTTTAATAGGATTCTTGG - Intronic
930228818 2:48822991-48823013 CTGCATTTTAACAAGATGCTGGG - Intergenic
930656914 2:54015731-54015753 CTGCATTTTAACAAGATCCCAGG + Intronic
931454204 2:62394601-62394623 CTGCATCTAAATAGGAAGAGAGG + Intergenic
934046153 2:88174101-88174123 CTGCATTTTAACAAGATCCCAGG + Intronic
935848646 2:107195480-107195502 CTGCTTTTGAATAAGAAGCTTGG - Intergenic
937037193 2:118792056-118792078 CTGCATTTTAACAGACACCCTGG - Intergenic
937431846 2:121845486-121845508 CTGTATCTTAAGAGGAACCCTGG - Intergenic
937685116 2:124687264-124687286 CTGCATTATAAGAGGGAGTCTGG + Intronic
938302428 2:130226639-130226661 CCACATTTTAGTGGGAAGCCTGG - Intergenic
938454256 2:131447612-131447634 CCACATTTTAGTGGGAAGCCTGG + Intergenic
939584513 2:143990298-143990320 CTACATATTAATGGGCAGCCAGG + Intronic
940617522 2:156068257-156068279 CTACATTTTAATAAGAAGTGAGG + Intergenic
941249982 2:163149138-163149160 CTGGGTTTCAATAGGAAGCATGG - Intergenic
941357255 2:164509736-164509758 CTGCATTTTAACAAGATCCCAGG + Intronic
942699411 2:178687314-178687336 CTGGATTTTAGTTGGAAACCTGG + Intronic
943706888 2:191045355-191045377 CTGCATTTTAACAAGAATCCTGG + Intronic
944113465 2:196161310-196161332 TTGCATTATAATAGGAAGAAAGG - Intronic
944635918 2:201676017-201676039 CTCCATTTTAATAAGAGCCCAGG + Intronic
944869322 2:203893987-203894009 CTGCATTTTAACAAGATCCCTGG + Intergenic
946484263 2:220085886-220085908 ATGCATTTTAAAAGGATTCCTGG + Intergenic
946673422 2:222131025-222131047 GTGCCTTTTCATAGGAAGTCTGG + Intergenic
947299104 2:228668179-228668201 CTGCATTTTAACAGAAGTCCTGG - Intergenic
948069321 2:235106903-235106925 CTTCATTTTAATTGGAAGACGGG - Intergenic
948752992 2:240143280-240143302 CTGCATTTTAACAGGACCCCTGG - Intronic
1169338060 20:4773688-4773710 CTGCGTTTTCACAGGAACCCTGG + Intergenic
1169463286 20:5815389-5815411 CTGTATTTTAATAGGATCCCTGG - Intronic
1169496474 20:6120759-6120781 CTGCATTTTAATAGGATCCCTGG - Intronic
1169641940 20:7761945-7761967 GTGCATTTAAATAGGACTCCTGG - Intergenic
1169724401 20:8713628-8713650 CTTCATTTTAATAAGACCCCAGG + Intronic
1170355618 20:15489035-15489057 CTGCATTTTTATAGGACACAAGG - Intronic
1170627999 20:18044140-18044162 CTGCATTTTAACAAGACCCCAGG - Intronic
1171233427 20:23505816-23505838 CTGCATTTTAATGAGATCCCAGG + Intergenic
1171757291 20:29122563-29122585 TTGCATTTTAATAAGATTCCAGG - Intergenic
1171784869 20:29454112-29454134 TTGCATTTTAATAAGATCCCCGG - Intergenic
1171785016 20:29455909-29455931 TTGCATTTTAATAAGATCCCCGG + Intergenic
1171863311 20:30421450-30421472 TTGCATTTTAATAAGATTCCAGG - Intergenic
1172618109 20:36303086-36303108 CTGCATTTTAACAAGACCCCTGG + Intergenic
1173016074 20:39226897-39226919 CTGCATTTTAACAAGATCCCAGG - Intergenic
1173176689 20:40770316-40770338 CTGCATTTAAATAAGATCCCTGG - Intergenic
1174207661 20:48852544-48852566 CTGCATTTTAAAAAGATGACCGG - Intergenic
1174501916 20:50991413-50991435 CTGCATTTCCATAAGAATCCAGG - Intergenic
1174710637 20:52701312-52701334 CTGCATTTTAACAGGATCCCAGG - Intergenic
1174791109 20:53479257-53479279 CTGCATTTTAATAGAATGTTTGG - Intronic
1175189420 20:57201135-57201157 CTGCATTTTACCAAGATGCCTGG + Intronic
1175336941 20:58202727-58202749 CTGTTTTTTAAAAGGCAGCCAGG + Intergenic
1175664013 20:60843077-60843099 CTGCATTTTAACAAGAGCCCAGG + Intergenic
1176012752 20:62908404-62908426 CTCCATTTCCATGGGAAGCCTGG - Intronic
1177461847 21:21422539-21422561 CTGCTCATTAATAGGAAGTCAGG - Intronic
1178396125 21:32245471-32245493 CTGCATTATAAGAGGAATTCAGG + Intergenic
1178623281 21:34194771-34194793 CTGCATTTTAATGAGATCCCAGG + Intergenic
1178755185 21:35342742-35342764 CTGCATTTCAAGGGGAAGCTTGG - Intronic
1179135133 21:38673148-38673170 CTGCATCTTTCTAGGAAGCGAGG + Intergenic
1179412962 21:41176222-41176244 CTGCATTTTAACAGGACCCCAGG - Intronic
1182021567 22:27085980-27086002 CTGCATTTTAATGGGCTCCCTGG - Intergenic
1182264722 22:29105254-29105276 CTGTATTTTAATAAGATCCCAGG - Intronic
1182322549 22:29487704-29487726 CTGCATTTTGATAAGATCCCCGG + Intronic
1182338687 22:29602571-29602593 CAGCAATTTCATAGGATGCCAGG + Intergenic
1184439780 22:44502357-44502379 CTGGATTCAAATAGGAAGCCTGG - Intergenic
949120336 3:376326-376348 TTGCATTTGAACATGAAGCCTGG - Intronic
950236678 3:11327824-11327846 TTGCATTTTAATAAGAACCCAGG - Intronic
951094327 3:18610263-18610285 CTGCATTTTAACAAGATCCCAGG + Intergenic
951113778 3:18836070-18836092 ATGCGATTTAATAGGAAGACAGG - Intergenic
952327352 3:32333453-32333475 CTGCATTTTAACAAGACCCCTGG + Intronic
952734323 3:36673898-36673920 CTGCATTTTAACAAGATCCCGGG + Intergenic
953583883 3:44182158-44182180 ATGAATTTCAAAAGGAAGCCAGG - Intergenic
953809142 3:46096997-46097019 CTGCATTTTAACAAGATCCCCGG + Intergenic
957060389 3:75476558-75476580 CTGCATTTTAACAAGATGCCTGG + Intergenic
957403456 3:79747270-79747292 CTGGATTTAAATAGGATACCAGG + Intronic
958098651 3:88980438-88980460 CTGAATTTATATATGAAGCCAGG - Intergenic
960794596 3:121472106-121472128 CTCCATTCTAATATCAAGCCTGG + Exonic
961134689 3:124499092-124499114 CTGGATTGTAAGAGGAAGACTGG - Intronic
961293003 3:125862852-125862874 CTGCATTTTAACAAGATGCCTGG - Intergenic
961922382 3:130441256-130441278 CTGCATTTTAACAAGATTCCTGG - Intronic
961998447 3:131270409-131270431 CTGCATTTTAACAAGATCCCTGG + Intronic
963326040 3:143864336-143864358 CTGCATTTTAACAGGTTTCCAGG - Intergenic
963615447 3:147531276-147531298 CTAAAGTTTATTAGGAAGCCAGG + Intergenic
963852903 3:150225549-150225571 CTGCATTTTAACAAGATCCCAGG + Intergenic
964199925 3:154107812-154107834 CTGCATTTTATAAAGCAGCCAGG - Intergenic
969784017 4:9438244-9438266 CTACATTTTAATCTGAAGACTGG - Intergenic
969995396 4:11307028-11307050 TTGCACTTTCATAGGAAACCTGG - Intergenic
971462175 4:26911632-26911654 CTGCATTTTTATAGCATTCCTGG + Intronic
971937886 4:33176198-33176220 TTGCATTCTTATAGGAAGGCAGG - Intergenic
973204064 4:47540394-47540416 CTGCAATTTAAAAGCATGCCCGG - Intronic
974161436 4:58145938-58145960 CTGGATATTAACTGGAAGCCTGG - Intergenic
975078615 4:70246533-70246555 CTGCATTTTTATAGGAAATGTGG - Intronic
976160785 4:82196536-82196558 ATGCATTTTAATAGGAATGTCGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978196020 4:105973009-105973031 CTGCATTTTAACAAGATTCCAGG - Intronic
978317798 4:107459051-107459073 CTTCATATTAACAGGAAGCGGGG + Intergenic
978962005 4:114691382-114691404 GTGTATTTTAACAGGAATCCGGG - Intergenic
980860553 4:138494826-138494848 CTGTATTTTAATAAGATCCCTGG - Intergenic
980890704 4:138811778-138811800 CTTAATTTTAAGAGGAAGCAAGG + Intergenic
982865268 4:160502202-160502224 CTGCACTTTAACAGGATCCCTGG - Intergenic
983248867 4:165321937-165321959 CTTCATTATAATACGAAGGCAGG - Intronic
983304287 4:165966364-165966386 CTGCATTTTAACTGGAATGCTGG - Intronic
984483732 4:180338572-180338594 CTGCATTTTAACAAGCACCCTGG + Intergenic
984874912 4:184358813-184358835 CAGCATTTGACTAGGTAGCCTGG + Intergenic
984970435 4:185184208-185184230 CTGCATTTTAACAGTATCCCTGG + Intronic
985376140 4:189340970-189340992 CTGCATTTTAACAGGATCTCCGG - Intergenic
988714222 5:33809180-33809202 CTGCAGTTTAACAGGATCCCTGG - Intronic
989666606 5:43861278-43861300 ATGCATTTTAAAAAGAAGCTGGG + Intergenic
990241187 5:53818234-53818256 CTGCATTTTAACAAGATCCCAGG + Intergenic
990265585 5:54071545-54071567 CTGCATTCAAGTAGGAAACCTGG + Intronic
990820892 5:59839172-59839194 CTGCATTTTAATGCTAAGCTGGG - Intronic
991456063 5:66805927-66805949 CTGCAAATTAAAAGGAAGCTTGG - Intronic
995625067 5:114067309-114067331 CTGCATTTTATCAGGTTGCCAGG - Intergenic
996794894 5:127334396-127334418 CTGCATTTTAACAAGATCCCAGG + Intronic
999266811 5:150271842-150271864 CTGCATTTTAACAAGACACCGGG - Intronic
999267211 5:150274653-150274675 CTGCATTTTAACAAGGTGCCTGG - Intronic
999831346 5:155323061-155323083 CTACATTTTAATGAAAAGCCTGG - Intergenic
1001424476 5:171614507-171614529 CTGCATTTTAACAGCACCCCTGG + Intergenic
1002355090 5:178620883-178620905 TTGCATCTTAAAGGGAAGCCAGG + Intronic
1003693351 6:8376843-8376865 CTGCATTTGAATAAGATCCCCGG + Intergenic
1004645418 6:17555503-17555525 CTGCATTTTAATAAGATCCTGGG + Intronic
1004677777 6:17860543-17860565 CTGCATCTTAGTAGAATGCCTGG + Intronic
1005957187 6:30672383-30672405 CTGCATTTTAACAAGAACCTTGG + Intronic
1006258902 6:32852702-32852724 CAGGATTTTATTAGGAAGGCTGG + Intronic
1006406217 6:33847247-33847269 CTGCATTTTAATAAGTTCCCTGG + Intergenic
1006508928 6:34511299-34511321 CTGCATTTTCACAGGATCCCAGG - Intronic
1008311335 6:49978341-49978363 CTGCATTTTAACAAGAACCCAGG - Intergenic
1009331183 6:62422721-62422743 ATGTAGTTTAATAGCAAGCCAGG + Intergenic
1011461024 6:87604301-87604323 CTACATTTTAATACGATCCCTGG - Intronic
1012502032 6:99898774-99898796 CTGCATTCTCATCTGAAGCCTGG + Intergenic
1013923193 6:115435127-115435149 GTGCATTTTAAAAGCAAGCTTGG + Intergenic
1015320826 6:131871959-131871981 CTGCATTTAAATACCAAGGCAGG - Intronic
1015943298 6:138473988-138474010 GTGGAATTTAATAGGAAGGCAGG + Intronic
1015946975 6:138512934-138512956 GTGCATTTTATTAGGAAACCAGG - Intronic
1016273495 6:142319383-142319405 CTCCTTTTTTATAGGAAGTCTGG + Intronic
1016701080 6:147054999-147055021 CAGCATTTTTATAGGACTCCGGG - Intergenic
1019819953 7:3235008-3235030 TTGCGTTTTAATAAGATGCCCGG + Intergenic
1019840073 7:3432639-3432661 TTGAATTTTAATAGGAACCTAGG + Intronic
1020717936 7:11701626-11701648 CTGCATTTTAACAAGACCCCAGG - Intronic
1021847976 7:24780939-24780961 CTGCATTTTAACATGTACCCAGG + Intergenic
1022273918 7:28837983-28838005 CTGCATTTTAATAAGAACCCAGG + Intergenic
1022308927 7:29176799-29176821 GAGCATATAAATAGGAAGCCAGG + Intronic
1022777003 7:33537176-33537198 CTGCAATTTAATAGGGAACATGG - Intronic
1024210981 7:47203739-47203761 CTGCATTTTCACAGGGACCCAGG - Intergenic
1026879695 7:73900685-73900707 ATGCATTATACAAGGAAGCCGGG - Intergenic
1027689845 7:81330770-81330792 TTCCATTTTAATAGGAAAGCAGG - Intergenic
1028512601 7:91641685-91641707 CTGCATTTTAATAAGATATCTGG + Intergenic
1029035475 7:97515807-97515829 CTGCATTTTTATAGGAAGTGGGG + Intergenic
1030098916 7:105927104-105927126 CTCCATTTTAATGTGCAGCCAGG - Intronic
1030550120 7:110947818-110947840 CCTGATTTTAATATGAAGCCAGG - Intronic
1031231251 7:119109571-119109593 CTGCATTATAATGTGAAGTCAGG + Intergenic
1032445112 7:131975526-131975548 ATGCATTTTAAAAGGAATCAAGG - Intergenic
1032474957 7:132205281-132205303 CTGCATTTTAGTAGGCCCCCCGG - Intronic
1032576599 7:133061123-133061145 CTGCATCCTAAGAGGAAGGCCGG + Intronic
1033372268 7:140720334-140720356 ATGCATTTTAAAATGAAGGCAGG + Intronic
1033520265 7:142153495-142153517 CTGAAGTTTCAGAGGAAGCCAGG + Intronic
1034027472 7:147721786-147721808 CTGCATTTTGACAGGAACACTGG + Intronic
1034690693 7:153011284-153011306 CTGTATTTTCAGAGGAAGTCAGG + Intergenic
1034948373 7:155279330-155279352 ATACATTTTAATCTGAAGCCAGG + Intergenic
1036835024 8:12055884-12055906 CTACATTTTAATCTGAAGACTGG + Intergenic
1036856867 8:12302448-12302470 CTACATTTTAATCTGAAGACTGG + Intergenic
1037156804 8:15710622-15710644 CTGCATTTTAATAAGTAGCCTGG - Intronic
1038537824 8:28366890-28366912 CTGGCTTTCAATAGAAAGCCAGG + Intronic
1039305097 8:36252817-36252839 CTTCAAATTAATAGGAAACCAGG + Intergenic
1041611745 8:59858209-59858231 AAGCATTTAAATAGGAAGCAAGG + Intergenic
1042081531 8:65059664-65059686 CAGCATTTTAATGGGAAAACAGG - Intergenic
1044543846 8:93437045-93437067 CAGCATATCAATAGGAAGCTGGG - Intergenic
1045327431 8:101127248-101127270 CTGCATTTTAACAAGATCCCAGG - Intergenic
1045984112 8:108227955-108227977 CTGCATTTTAATAAGATCCCAGG - Intronic
1046808017 8:118501706-118501728 CTGCATTTTAACAGGATCTCAGG - Intronic
1047681012 8:127254079-127254101 CCCTATTTTAATAGCAAGCCTGG - Intergenic
1047774917 8:128062068-128062090 CTACATCTCAATAGGGAGCCTGG + Intergenic
1049930848 9:455120-455142 CTGCATTGTTCTAGGAGGCCAGG + Intronic
1050950284 9:11582450-11582472 CTTCATTTTAATACTCAGCCAGG - Intergenic
1051348050 9:16170598-16170620 CTGCCTTATAATAAGAAGACTGG + Intergenic
1051523912 9:18021031-18021053 TTCCATTTTAATAGGATCCCAGG - Intergenic
1052330659 9:27264519-27264541 CTGCATTTTAACAAGAGTCCCGG + Intergenic
1052373162 9:27688826-27688848 CTGCATTTTAATGAGATCCCTGG + Intergenic
1052402139 9:28013690-28013712 CTGCTTCTTATTAGCAAGCCAGG - Intronic
1053267276 9:36724439-36724461 CTGCATTGTAATAAGAGCCCTGG + Intergenic
1053402509 9:37838593-37838615 ATTCATTTTAAAAAGAAGCCGGG + Intronic
1053596550 9:39567760-39567782 CCGCATTTAAATATGAAGACAGG - Intergenic
1053854517 9:42324400-42324422 CTGCGTTTAAATATGAAGACAGG - Intergenic
1054361395 9:64123988-64124010 CTGCATTTAGAAAGGAAGCGGGG + Intergenic
1054832174 9:69637812-69637834 TTACATTTTAATAGGAAAGCTGG + Intronic
1055550563 9:77428670-77428692 CTGCATTTTAACAAGAACCCAGG - Intronic
1057889743 9:98860509-98860531 CTGCCTTTTAACAAGATGCCAGG - Intergenic
1058469680 9:105264578-105264600 GTGCATATTAATAGAAAGCTGGG - Intronic
1058726755 9:107812049-107812071 CTGCATTTTAACAAGATCCCTGG + Intergenic
1059337109 9:113575912-113575934 CTGCACTTTAATAGGATCCCAGG - Intronic
1059620761 9:116003081-116003103 CTACTTTTTAATAGGAAGGGTGG + Intergenic
1202801151 9_KI270720v1_random:257-279 TTGCATTTTAATAAGATTCCAGG + Intergenic
1203445809 Un_GL000219v1:55064-55086 TTGCATTTTAATAAGATCCCCGG + Intergenic
1185557357 X:1031854-1031876 CTTCATATTAATCGGCAGCCGGG + Intergenic
1186127450 X:6429354-6429376 GTGCATTCTAGCAGGAAGCCTGG + Intergenic
1187426788 X:19184749-19184771 CTGCATTTTAACAAGATGTCTGG - Intergenic
1187568070 X:20472882-20472904 TTGAATTTTAATAGGAATTCAGG - Intergenic
1187783882 X:22862314-22862336 CTGCATTTTAACAGGAACCTTGG - Intergenic
1189012514 X:37060670-37060692 CTGCATTCTAATATGCAGCAAGG + Intergenic
1189030582 X:37445401-37445423 CTGCATTTTAACAGGCTCCCAGG + Intronic
1189684531 X:43550175-43550197 TTTCATTTTAATAGAAAGGCTGG - Intergenic
1189737704 X:44088288-44088310 CTGCATTTTAACAGGATCCCCGG - Intergenic
1190999954 X:55649134-55649156 ATGCATTTTAAAAGGTAGCTTGG + Intergenic
1193421515 X:81289011-81289033 CTGTATTATAATTGGAAGTCAGG - Intronic
1193898032 X:87138414-87138436 CTGCATTATAATTTGAAGTCAGG - Intergenic
1194012126 X:88575097-88575119 AGGCATTTAAATAGGAAACCAGG + Intergenic
1194561624 X:95428434-95428456 CTGCAGTATAATAGAACGCCAGG + Intergenic
1196148083 X:112341997-112342019 TTGCATTTTAAGAGGACTCCGGG + Intergenic
1196994624 X:121368574-121368596 CTGCAGTATAATTTGAAGCCAGG - Intergenic
1197875475 X:131099816-131099838 CTGCATTTAAATAGGAATTTTGG + Intergenic
1199654450 X:149980815-149980837 CTGGATTTTAATAAGATGCTAGG + Intergenic
1201609670 Y:15826847-15826869 GTGCATTCTAGCAGGAAGCCTGG + Intergenic
1201628007 Y:16036177-16036199 CTGCATATTCATAGGAATTCAGG - Intergenic
1201748142 Y:17403054-17403076 CTGCATTGTAATAGGAATGTCGG - Intergenic