ID: 1151460586

View in Genome Browser
Species Human (GRCh38)
Location 17:74252004-74252026
Sequence CTGAGCACTTACTGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2901
Summary {0: 1, 1: 4, 2: 80, 3: 601, 4: 2215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151460586_1151460591 20 Left 1151460586 17:74252004-74252026 CCCAGCTCACAGTAAGTGCTCAG 0: 1
1: 4
2: 80
3: 601
4: 2215
Right 1151460591 17:74252047-74252069 CCAAGAAGCCCCATTGTGTTAGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151460586 Original CRISPR CTGAGCACTTACTGTGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr