ID: 1151461428

View in Genome Browser
Species Human (GRCh38)
Location 17:74256443-74256465
Sequence GCAGGCTTGCTAGCAGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151461428_1151461437 21 Left 1151461428 17:74256443-74256465 CCTCTACCTGCTAGCAAGCCTGC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1151461437 17:74256487-74256509 TCACTCCTGTGCCACCACCTTGG 0: 1
1: 0
2: 1
3: 14
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151461428 Original CRISPR GCAGGCTTGCTAGCAGGTAG AGG (reversed) Intronic
900288683 1:1914626-1914648 GCAGGTTTGCTGGCAGGCAGAGG + Intergenic
900974649 1:6009352-6009374 GCAGGCTGGCTAACGGGTGGAGG + Intronic
902665021 1:17931414-17931436 GCAGGCTGGGTGGCAGGGAGAGG - Intergenic
902937328 1:19773581-19773603 GCAGCCTTGCCAGCAGCTGGGGG + Intronic
905273399 1:36801692-36801714 GCTGGCTTCCTGGCAGGTAAGGG + Exonic
910868497 1:91809772-91809794 GCAGGCTAGCTAGCCTGAAGAGG - Intronic
915581209 1:156814376-156814398 GCATGCTTGCTTGGGGGTAGGGG - Intronic
918004676 1:180530627-180530649 GGAGGCTTGCTGGTAGGGAGTGG - Intergenic
918099993 1:181364906-181364928 GCAGCCCTGCTGGCAGGAAGGGG - Intergenic
922883310 1:228998989-228999011 CCAGGCTTGTTAGTAGATAGAGG + Intergenic
924818096 1:247460451-247460473 CCAGGCTTTCTAACAGATAGGGG + Intergenic
1064097776 10:12436579-12436601 TCAGGCTTCCCACCAGGTAGGGG - Intronic
1065275039 10:24077223-24077245 GCAGGTTTGTTACCAGGTAAAGG + Intronic
1067030239 10:42875000-42875022 GCAGGCTTGGTAGCTGGGGGTGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1071494942 10:86161756-86161778 ACAGGCTTGCAAGCAGGTGGTGG + Intronic
1073506835 10:104002172-104002194 GCACGCTTACTTGCAGGTATTGG - Exonic
1076050557 10:127329776-127329798 GCAGGATTGGGAGGAGGTAGAGG + Intronic
1076529599 10:131135752-131135774 GCAGCCTTGCTGGAAGGTACAGG - Intronic
1077645276 11:3918155-3918177 GCAGGCTTTCTCCCATGTAGTGG + Intronic
1079544576 11:21617382-21617404 CCAAGCTTTCTAGCAAGTAGTGG + Intergenic
1084195740 11:67523011-67523033 GGAGGCTGGCTAGCAGAGAGCGG + Intronic
1084898522 11:72293137-72293159 GAAGGCTTGTTAGCAGGTTATGG + Exonic
1084955510 11:72689263-72689285 GCAGGCTGGCTCGGAGGCAGAGG + Intronic
1087071381 11:94084474-94084496 TCAGTCTTGCTTGCAGGGAGTGG + Intronic
1089446026 11:118552996-118553018 GCAGGATTGCTTGCAGATCGAGG + Intronic
1091891861 12:4062295-4062317 GAAGGATTGCTAGGAGGCAGAGG + Intergenic
1091905477 12:4183970-4183992 CCAGGCTTCCTTGCAGCTAGAGG + Intergenic
1092226343 12:6750547-6750569 GCAGGCATGACAGCAGGTACAGG + Intronic
1095865105 12:46963304-46963326 GCATGCTTACTAGCAGCTGGTGG + Intergenic
1102720658 12:115013402-115013424 GCAGGCCTGCTATCTGGTAATGG - Intergenic
1104592829 12:130098482-130098504 GCAGGGTGGCTAGCATCTAGGGG - Intergenic
1104889630 12:132134088-132134110 GCAGGCCTACATGCAGGTAGGGG + Intergenic
1105647719 13:22339050-22339072 GCAGGCTTAATACCAGGTGGAGG - Intergenic
1105665699 13:22553285-22553307 TCAGTCTAGCTATCAGGTAGGGG - Intergenic
1106183954 13:27392072-27392094 GCATGCTTTCTAGGAGGTATTGG - Intergenic
1106380160 13:29228997-29229019 GCAGGCATGCTAGCAGCCGGAGG - Intronic
1108095698 13:46898205-46898227 GCACGCTGGCGAGCAGGCAGCGG + Intergenic
1108443076 13:50476134-50476156 TCAGGCATGCTAGCAGGCAGGGG - Intronic
1111064417 13:83072202-83072224 GCAGGCTTGTTGGCAGGTAAGGG - Intergenic
1111783970 13:92764256-92764278 GAAGGCTGGCTATCAGGCAGAGG + Intronic
1116433164 14:44869602-44869624 GCAAGCTTGCCAGCAAGCAGAGG - Intergenic
1118216050 14:63809504-63809526 GCAGCCTTGGTAACAGGGAGAGG - Intergenic
1118365933 14:65096131-65096153 CCAGGCTTTCTACCAGGCAGTGG - Intronic
1120131119 14:80808555-80808577 GCTTGCTTGCATGCAGGTAGTGG - Intronic
1121247321 14:92471409-92471431 CTAGGCTTCCTTGCAGGTAGGGG - Intronic
1128914577 15:71548212-71548234 GCAGGCTTGTTTGCAGGTGAGGG - Intronic
1129330644 15:74825579-74825601 GCAGGCATGCTGGCAGGGAGAGG - Exonic
1130068512 15:80627033-80627055 GCAGGCAGGCAAGCAGGCAGGGG - Intergenic
1130912588 15:88281302-88281324 TCAGGATTGCTGGCAGGCAGAGG + Intergenic
1132013955 15:98299887-98299909 GAAGGCTTGCCAGCAGAGAGCGG - Intergenic
1132412990 15:101599162-101599184 GGAGGCTAGCTAGAAGGAAGTGG - Intergenic
1135922133 16:26660379-26660401 TGAGCCTTGCTAGCAGGTGGTGG + Intergenic
1139921164 16:70461438-70461460 GCAGGAGTGCTGGCAGGTTGGGG + Intronic
1142126109 16:88411464-88411486 GCAGGGGTGCAAGCAGGCAGGGG + Intergenic
1142126118 16:88411496-88411518 GCAGGGGTGCAAGCAGGCAGGGG + Intergenic
1144375714 17:14638505-14638527 GCAGGCAGGCTAGCAGGTAATGG + Intergenic
1144737256 17:17562024-17562046 CCAGCCTTGCTGGCAGGAAGAGG - Intronic
1147304927 17:39556654-39556676 GCAGGATTGTTGGCAGGGAGGGG - Intronic
1150124881 17:62629179-62629201 GCAGGAGTGCGAGGAGGTAGGGG - Intronic
1151461428 17:74256443-74256465 GCAGGCTTGCTAGCAGGTAGAGG - Intronic
1151770266 17:76156018-76156040 GCAGGCTTGCCTGTAGCTAGTGG - Intronic
1152255072 17:79234221-79234243 TCCGGCTTTCTAGCAGGAAGAGG - Intronic
1161686980 19:5707783-5707805 GCAGGCTGGCCAGCGGGTGGTGG - Exonic
1164400418 19:27898344-27898366 GCAGGCTGGCTAACAGGAAGAGG + Intergenic
1166163883 19:40972686-40972708 GCATGCTAGGTATCAGGTAGTGG + Intergenic
926145250 2:10393374-10393396 CCAGGCTTCCTAGCAGGAAGGGG - Intronic
926163123 2:10501956-10501978 GAAGGCTGGGTAGCAGGAAGGGG - Intergenic
929758571 2:44787851-44787873 GCAGCCACGCTGGCAGGTAGTGG + Intergenic
929919184 2:46160561-46160583 GCAGGCTTGCTGGGAGGTGAAGG + Intronic
930197726 2:48526076-48526098 GTTGGCTTGCTTGCAGGTATAGG + Intergenic
933649667 2:84840462-84840484 CCAGGCTGGCCAGCAGGGAGTGG - Intronic
935352087 2:102159776-102159798 GCAGGCTTGCAAGAAGAGAGAGG - Intronic
936944887 2:117921415-117921437 GGAGGTTTGCTAGCAGATGGAGG - Intronic
939189308 2:138897423-138897445 GCAGGCATGCCAGGAGGTGGTGG + Intergenic
941713266 2:168737096-168737118 GCTGGCATGCTATCAGGAAGAGG - Intronic
948291986 2:236832384-236832406 GCAGGCCTGGGAGCAGGTGGGGG + Intergenic
948480008 2:238243324-238243346 GCAGCCAGGCTAGCAGGCAGAGG + Intergenic
948733233 2:239980304-239980326 TCAGGCTTGGCAGCAGGTATTGG + Intronic
1169207664 20:3749303-3749325 GCAGAGATGCAAGCAGGTAGGGG + Exonic
1172436000 20:34929353-34929375 GCACTCTTGCAAGCAGGTAGTGG + Intronic
1172757300 20:37295031-37295053 CCAGACTTGCTTACAGGTAGAGG - Intronic
1173854878 20:46243717-46243739 TCAGGCTGGGAAGCAGGTAGAGG - Intronic
1179926880 21:44539602-44539624 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179926916 21:44539854-44539876 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179928423 21:44551162-44551184 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179929585 21:44558419-44558441 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179931543 21:44574063-44574085 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179931562 21:44574201-44574223 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179931599 21:44574420-44574442 GCAGGCCTGCTGGCAGGAGGAGG - Exonic
1179931615 21:44574546-44574568 GCAAGCCTGCTGGCAGGGAGAGG - Exonic
1179932629 21:44580315-44580337 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179934135 21:44591675-44591697 GCAGGCGTGCTGGCAGGGGGAGG + Exonic
1179934154 21:44591801-44591823 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179934191 21:44592020-44592042 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179934209 21:44592158-44592180 GCAGGCCTGCTGGCAGGGGGAGG + Exonic
1179935423 21:44600926-44600948 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179935441 21:44601064-44601086 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179939223 21:44627446-44627468 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179940726 21:44637677-44637699 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179942067 21:44646733-44646755 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1179948659 21:44697491-44697513 GCAGGCCTGCTGGCAGGGGGAGG - Exonic
1180000989 21:44995439-44995461 GCAGGCTTGCAGGCAGCTGGAGG + Intergenic
1184614322 22:45627704-45627726 CCAGGCTTGCTGACAGGCAGAGG + Intergenic
949608325 3:5677917-5677939 ACAGGCTTGCAAGCAGGTGGTGG + Intergenic
951930719 3:27964121-27964143 GAATGCTTGCTAGTGGGTAGTGG - Intergenic
953919925 3:46944673-46944695 GAAGGCTGGCTGGCAGGCAGGGG - Intronic
954629234 3:52039307-52039329 GGAGGCTTCCTAGCAGGGAGAGG - Intergenic
955484824 3:59424741-59424763 GCAGGCTGTCTATCAGGGAGAGG + Intergenic
956028424 3:65009047-65009069 CCAGAGTTGCTAGCAGGTAATGG - Intergenic
957615431 3:82520089-82520111 ACAGGCATCCTTGCAGGTAGTGG - Intergenic
960695722 3:120394483-120394505 GTGGGCTTGTTAGCAGGCAGAGG + Exonic
961041166 3:123679454-123679476 GCAGGGGTGCAAGCAGGTGGAGG + Intronic
969434857 4:7183033-7183055 CCAGCCTTGCTTGTAGGTAGAGG + Intergenic
987966783 5:24887630-24887652 GCAGGCCTGTTGGCAGGTGGGGG + Intergenic
993353542 5:86879281-86879303 GCAGATTTGCTTGCAGTTAGAGG + Intergenic
997366163 5:133326578-133326600 GCGGGCTTTCTGGCAGGGAGTGG - Intronic
1002490683 5:179574491-179574513 GCAGGCTTGCTAGAACTTACTGG + Intronic
1003479372 6:6517140-6517162 GCAGGCTTGGTTGCAGGAGGCGG + Intergenic
1006099205 6:31675614-31675636 GCAGGCTTGGCTGCAGGTAAAGG - Intergenic
1009199493 6:60726377-60726399 CCAGGCATTCTAGCAGGGAGGGG + Intergenic
1011448769 6:87471605-87471627 GCACACTTACTACCAGGTAGAGG + Intronic
1011674838 6:89722556-89722578 ACAGGCTTGCTAGCCGGGCGTGG + Intronic
1014309961 6:119787468-119787490 GTAGGCTTGCTGGCATTTAGTGG + Intergenic
1017996009 6:159532245-159532267 GCAGGCTTCATGGCAGGCAGAGG - Intergenic
1019460821 7:1157961-1157983 GCAGGCTGGCTAGCAGGGCCAGG - Intronic
1021511372 7:21436276-21436298 GCAGGCATGAAAGCAGGTTGAGG + Intronic
1028309528 7:89313616-89313638 GCATTCTTGCTGGCAGGTAGGGG + Intronic
1028960470 7:96743487-96743509 GCAGGCTTTATAGCAGCGAGAGG - Intergenic
1029313923 7:99693925-99693947 TCAGACTTGCTGGCAGTTAGAGG + Intronic
1029322616 7:99778173-99778195 TCAGACTTGCTGGCAGTTAGAGG + Intronic
1029587982 7:101487426-101487448 GAAGGCCTGGTAGCAGGCAGAGG - Intronic
1030698687 7:112615050-112615072 GCAGCCTTGGAAGCAGGTAGTGG - Intergenic
1030790961 7:113728252-113728274 GCAGGCTTAGTATCAGGTAGTGG - Intergenic
1032709835 7:134451827-134451849 GCAGGCTGGTCAGCAGGTATCGG - Intronic
1033653418 7:143358820-143358842 GCACGTTTTCTAGCAGGTACAGG - Exonic
1036163149 8:6407075-6407097 GCAGGGGTGAAAGCAGGTAGGGG - Intronic
1036658441 8:10692369-10692391 GAAGGGTTTCCAGCAGGTAGGGG - Intronic
1043018846 8:74975360-74975382 ACAGGCTTGGTAGCAAGAAGAGG + Intergenic
1046631540 8:116626926-116626948 GCAGGCTTTTCAGCAGGTGGAGG + Intergenic
1046738619 8:117804850-117804872 TCAGGCTGGCTGGCAGGTAATGG + Exonic
1049848981 8:144820697-144820719 GCAGGCTTGCCAGGACGGAGCGG + Intergenic
1050287015 9:4114050-4114072 GCAGTTGTGCTAGCAGGTTGGGG - Intronic
1060009295 9:120029237-120029259 GCAGGGTTGCCAGAAGGTAAGGG + Intergenic
1185695685 X:2192730-2192752 GCATGGATGCTAGCAGGTGGAGG + Intergenic
1185854801 X:3524117-3524139 GCAGCCTCCCTTGCAGGTAGTGG + Intergenic
1185908311 X:3958556-3958578 GCAGGCTTGTTATCAGGGGGTGG + Intergenic
1188964724 X:36537126-36537148 GCAGGCTTACTACCATGTGGAGG - Intergenic
1190217930 X:48492570-48492592 GCAGGCTTCCTAGAGGGGAGGGG + Intergenic
1195968261 X:110448684-110448706 GCAGGCTGGCTGGCGGGCAGGGG + Intronic
1198685802 X:139226894-139226916 GCATGATTGCTGGCATGTAGGGG - Intergenic
1202095465 Y:21244652-21244674 GCAGATTTCCTAGCAGGCAGAGG + Intergenic