ID: 1151466471

View in Genome Browser
Species Human (GRCh38)
Location 17:74288996-74289018
Sequence TCACTACCACGACTGACTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151466469_1151466471 -3 Left 1151466469 17:74288976-74288998 CCAGCTCTGGGGAATTCATTTCA 0: 1
1: 0
2: 5
3: 81
4: 824
Right 1151466471 17:74288996-74289018 TCACTACCACGACTGACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 60
1151466468_1151466471 -2 Left 1151466468 17:74288975-74288997 CCCAGCTCTGGGGAATTCATTTC 0: 1
1: 1
2: 1
3: 15
4: 232
Right 1151466471 17:74288996-74289018 TCACTACCACGACTGACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 60
1151466467_1151466471 6 Left 1151466467 17:74288967-74288989 CCTCAGATCCCAGCTCTGGGGAA 0: 1
1: 0
2: 5
3: 35
4: 400
Right 1151466471 17:74288996-74289018 TCACTACCACGACTGACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151466471 Original CRISPR TCACTACCACGACTGACTTA GGG Intronic