ID: 1151466471 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:74288996-74289018 |
Sequence | TCACTACCACGACTGACTTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 61 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 60} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151466469_1151466471 | -3 | Left | 1151466469 | 17:74288976-74288998 | CCAGCTCTGGGGAATTCATTTCA | 0: 1 1: 0 2: 5 3: 81 4: 824 |
||
Right | 1151466471 | 17:74288996-74289018 | TCACTACCACGACTGACTTAGGG | 0: 1 1: 0 2: 0 3: 0 4: 60 |
||||
1151466468_1151466471 | -2 | Left | 1151466468 | 17:74288975-74288997 | CCCAGCTCTGGGGAATTCATTTC | 0: 1 1: 1 2: 1 3: 15 4: 232 |
||
Right | 1151466471 | 17:74288996-74289018 | TCACTACCACGACTGACTTAGGG | 0: 1 1: 0 2: 0 3: 0 4: 60 |
||||
1151466467_1151466471 | 6 | Left | 1151466467 | 17:74288967-74288989 | CCTCAGATCCCAGCTCTGGGGAA | 0: 1 1: 0 2: 5 3: 35 4: 400 |
||
Right | 1151466471 | 17:74288996-74289018 | TCACTACCACGACTGACTTAGGG | 0: 1 1: 0 2: 0 3: 0 4: 60 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151466471 | Original CRISPR | TCACTACCACGACTGACTTA GGG | Intronic | ||