ID: 1151468825

View in Genome Browser
Species Human (GRCh38)
Location 17:74305135-74305157
Sequence GCATGGACAGGAGCTTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151468825_1151468830 -1 Left 1151468825 17:74305135-74305157 CCCAAGCAAGCTCCTGTCCATGC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1151468830 17:74305157-74305179 CCCGCTAATCCCAGAATTGATGG 0: 1
1: 0
2: 0
3: 3
4: 113
1151468825_1151468832 6 Left 1151468825 17:74305135-74305157 CCCAAGCAAGCTCCTGTCCATGC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1151468832 17:74305164-74305186 ATCCCAGAATTGATGGTTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151468825 Original CRISPR GCATGGACAGGAGCTTGCTT GGG (reversed) Intronic
900368610 1:2321603-2321625 GAAGGGACAGGAGCCTGCTGAGG - Intronic
903650181 1:24917234-24917256 GCATGGACAGGAGCCTCAGTTGG - Intronic
905030026 1:34876041-34876063 GCATGGGCAGGAGCTGTCTCTGG + Intronic
909465871 1:75973488-75973510 GCATAGCCAGTGGCTTGCTTTGG - Intergenic
910485258 1:87706007-87706029 GTGTGGACAGGGGCTTGCTTGGG + Intergenic
911229515 1:95346185-95346207 GAATGGTGAGGAGCTTGCCTTGG + Intergenic
912374352 1:109198324-109198346 GCATACACTGGAGCCTGCTTAGG - Intronic
914357544 1:146899728-146899750 GCAGGGAGAGGAACTTTCTTTGG + Intergenic
916925985 1:169521328-169521350 GCAGGGGCAGGAGCTTCATTAGG - Intronic
917341201 1:173979774-173979796 GTTTGGACAGGAGCTTGTATCGG - Intronic
923775193 1:236971673-236971695 GCAAAGACAGGAGCATCCTTGGG - Intergenic
924615995 1:245612502-245612524 CCAGGGAAAGGAGTTTGCTTTGG + Intronic
1064565581 10:16635823-16635845 GCAAGGCCAGGAGCTGGCTTTGG - Intronic
1064643114 10:17434181-17434203 GCAGGGACAGATGCTTTCTTGGG + Intronic
1065747696 10:28857280-28857302 GCATGGACAGTAGGTTGCTGGGG - Intronic
1067063443 10:43089923-43089945 GCTGGGACAGGAGCTTGTTCAGG + Intronic
1067206239 10:44216231-44216253 GCAAAGAGAGGAGCTTGCTCAGG - Intergenic
1069684615 10:70309696-70309718 GGCTGAACAGGAGCTTGCTAAGG + Intronic
1071368780 10:84928791-84928813 GGATGGACAGCAGCCTTCTTAGG + Intergenic
1071451024 10:85791479-85791501 CCAGGGTCAGGAGCTTGCTGGGG - Intronic
1072207407 10:93216465-93216487 GCATGGTTAGGATATTGCTTGGG - Intergenic
1074137726 10:110643140-110643162 GCCTGGAGAGGAGTTTGCTCAGG - Intergenic
1075358199 10:121802808-121802830 GCATGCCCAGGACCTTGCTAAGG - Intronic
1076901440 10:133340368-133340390 GCAATGACAGGAGCATGCGTTGG + Intronic
1081814441 11:45930632-45930654 GCCTGGACAGGAGCTGGCAGGGG + Intronic
1082998355 11:59270214-59270236 GCAGGGATAGGAGCCTTCTTGGG + Intergenic
1083857035 11:65398290-65398312 GCCTGGCTGGGAGCTTGCTTTGG + Intronic
1084288596 11:68147383-68147405 GCAGGGACAGTGACTTGCTTGGG - Intergenic
1085014185 11:73161987-73162009 GTATAGACAGGAGTCTGCTTAGG - Intergenic
1085580446 11:77645448-77645470 GGATGGACAGGAGGATGCATAGG - Intergenic
1087304441 11:96472482-96472504 GAATGGACTGCATCTTGCTTGGG + Intronic
1092335839 12:7632478-7632500 GCATTGACTGTAGATTGCTTTGG + Intergenic
1093483850 12:19631709-19631731 CCTTGGACATGAGCTTCCTTTGG + Intronic
1093892060 12:24533997-24534019 GAATGGACAGGGCCATGCTTTGG - Intergenic
1094523609 12:31217948-31217970 GGATGGGCAGGACCATGCTTGGG + Intergenic
1096563233 12:52451909-52451931 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1096565385 12:52473568-52473590 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1096567405 12:52493019-52493041 GCATGTGGAGGAGCTGGCTTTGG - Exonic
1096584107 12:52608401-52608423 GCAGGCACAGGGGCTGGCTTTGG - Exonic
1102450806 12:113040778-113040800 GCTTGAACAGGAACTTGCCTAGG - Intergenic
1103012714 12:117469549-117469571 ACATGGATAGGAGCTTGTTGGGG + Intronic
1107140464 13:36993175-36993197 GCATTGGCAGGATCTGGCTTAGG - Intronic
1108153463 13:47560762-47560784 ACATGGACATAGGCTTGCTTTGG - Intergenic
1110267324 13:73553131-73553153 GTATGGTGAGGAGCTAGCTTTGG - Intergenic
1112579930 13:100669800-100669822 TCCTGGACAGGTGCTTTCTTTGG + Intronic
1113031269 13:105996509-105996531 GCTGGGCGAGGAGCTTGCTTCGG - Intergenic
1116426838 14:44800707-44800729 GTATGAACAGGAGCTAGTTTGGG + Intergenic
1117866218 14:60152316-60152338 GCAAGGAGAGAAGCTTGATTTGG - Intronic
1118299559 14:64602949-64602971 GGCAGGACAGGAGCATGCTTTGG + Intergenic
1122906035 14:104801933-104801955 GCAGGAACAGGAGGTGGCTTCGG - Exonic
1125427675 15:39566031-39566053 GAGTGGCCAAGAGCTTGCTTGGG - Intergenic
1126816886 15:52462472-52462494 GCATGGCCAGCAGCTGGCTTGGG - Intronic
1129766735 15:78174399-78174421 GCATGGACAGGAACTTCCTCTGG + Exonic
1131177877 15:90221206-90221228 GAATGGCCAGGGGCTTGCCTTGG + Intronic
1132501923 16:288339-288361 GCATGGACAGGAGGCTCCTCGGG - Intronic
1133034122 16:3025550-3025572 GCATGGGCAGGTGCTGGCTTGGG + Intronic
1137434578 16:48445106-48445128 GCTTGTCCAGGAGCTTGCCTGGG + Intronic
1138134633 16:54511101-54511123 GCAGGGACAGAAGCTTTCTCTGG - Intergenic
1138393291 16:56685341-56685363 GCATGGGCAGGAGCGTGATGTGG + Intronic
1141003007 16:80325612-80325634 GAAAGGACAGGAGCTGGTTTGGG - Intergenic
1142713278 17:1734955-1734977 GCAGAGAGAGGAGGTTGCTTTGG + Intronic
1144967275 17:19085587-19085609 GGATGGACTGGGGCTTTCTTGGG - Intergenic
1144980645 17:19166479-19166501 GGATGGACTGGGGCTTTCTTGGG + Intergenic
1144987577 17:19211754-19211776 GGATGGACTGGGGCTTTCTTGGG - Intergenic
1147904046 17:43811256-43811278 GCAGGGACAGCAGCAGGCTTAGG + Intronic
1151468825 17:74305135-74305157 GCATGGACAGGAGCTTGCTTGGG - Intronic
1157745424 18:50130897-50130919 GGAAGGAGAGGAGCTTGGTTAGG - Intronic
1158473040 18:57755384-57755406 TCCTGGACATGTGCTTGCTTCGG + Intronic
1159184143 18:64947840-64947862 GCATGCCCAGGAGGTTGTTTGGG + Intergenic
1160856182 19:1219006-1219028 GCATGGGCCCGAGCCTGCTTGGG + Intronic
1161250174 19:3276069-3276091 GCATGGGGAGGAGCTGGCTCTGG + Intronic
1163008516 19:14410777-14410799 GGAGGGACGGGGGCTTGCTTGGG + Intronic
1163595147 19:18216971-18216993 GCATGGGTAGGAGTTTGCTAAGG - Intronic
1166088861 19:40495168-40495190 GCCTGGACAGGAGCCTGTGTGGG - Intronic
1167204382 19:48090697-48090719 GCATGGACAGGAGCTTGAAATGG - Intronic
1167977774 19:53244678-53244700 GCATTGACTGTAGATTGCTTTGG - Intronic
925536845 2:4927144-4927166 GCATTGACAAGAGCTGGTTTGGG + Intergenic
925817248 2:7766143-7766165 GCATCCACAGCAGCTTGCTTAGG - Intergenic
926507181 2:13731705-13731727 TCATTGACAGGTGATTGCTTTGG + Intergenic
931953921 2:67397222-67397244 GCCGGGACAGGAGCCTGCTCTGG - Intergenic
933619894 2:84526667-84526689 AGATGGACAGGAGCTTATTTTGG + Intronic
934735392 2:96687385-96687407 GCATGGCCAGGAGTTGGCCTAGG - Intergenic
934779837 2:96962765-96962787 GCATGCACAGATGCTTGCTCGGG + Intronic
936534441 2:113301197-113301219 GCATGGTCAGGAGCATGGTGAGG - Intergenic
937218311 2:120326829-120326851 GCCTGGAAAGGAGCTTGGCTGGG + Intergenic
938206117 2:129425343-129425365 GAATGGACAGGAGTTTACTTGGG + Intergenic
943824633 2:192373365-192373387 GCATAGACAGGAACTTGTGTAGG + Intergenic
944390010 2:199208263-199208285 GGATGGTCAGGAGCTAGGTTTGG - Intergenic
945261948 2:207851817-207851839 GAATGGAGGGGAGGTTGCTTTGG + Intronic
945453519 2:210021293-210021315 GCACAGACTAGAGCTTGCTTGGG + Exonic
946368592 2:219266538-219266560 GCCTGGACAGGGGCTGGCTGGGG - Intronic
947043400 2:225949716-225949738 ACATGTGCAGGTGCTTGCTTTGG - Intergenic
948510017 2:238457870-238457892 GCGTGGACATGACCTAGCTTCGG + Intergenic
1168741348 20:193914-193936 GCATGGGCTGGAGCTTGCCCTGG + Intergenic
1170733184 20:18991382-18991404 GAAGTGACTGGAGCTTGCTTTGG - Intergenic
1177841320 21:26236897-26236919 GGATGGACAGGAGTGTGGTTGGG - Intergenic
1179613110 21:42565054-42565076 GGATGGGCAGGAGCTTGTCTGGG - Intronic
1179878811 21:44285050-44285072 GCCTGGACAGGAGCTTCCGGGGG - Intergenic
1181913249 22:26257242-26257264 TCAAGGACTAGAGCTTGCTTAGG - Intronic
949684196 3:6549430-6549452 GCATGGAGAGGAGTTTGGCTGGG + Intergenic
952561537 3:34599510-34599532 GCAGGGACATGAGCATGCTCTGG - Intergenic
952920770 3:38282454-38282476 GTGTGGACAGGAGCCTGCCTGGG + Intronic
952922170 3:38293072-38293094 GCATGGGCTGGTGCTTGCTCCGG + Intronic
953021388 3:39116024-39116046 GCCTTGGTAGGAGCTTGCTTTGG + Intronic
954145231 3:48631162-48631184 GCCAGGACAGGACCTTGCTTTGG - Intronic
955194225 3:56790172-56790194 CGAGGAACAGGAGCTTGCTTCGG - Intronic
955800619 3:62682346-62682368 GAATGGACTGGAGCTTAATTGGG + Intronic
955852994 3:63241155-63241177 GCATTAGCAGGAGCTTGCGTTGG + Intronic
957916422 3:86693471-86693493 GCATGAACTGGAGCTTGCCTTGG + Intergenic
963172588 3:142266127-142266149 GCATGTACAGGAGATGGCCTTGG - Intergenic
965061214 3:163787774-163787796 GCATGGAGTGGAGCTAGCGTGGG + Intergenic
967540095 3:190657010-190657032 GCATGGAAAGGAGCTGGTTCTGG + Exonic
967623617 3:191662365-191662387 GCATGGGCTGGCGCTTGCCTCGG - Intergenic
968547148 4:1205212-1205234 ACATGGACAGGAACTGGCTGTGG + Intronic
969898783 4:10329350-10329372 GCACTGACAGGTGCTTCCTTAGG + Intergenic
971211629 4:24623333-24623355 GCATGGTCAGGATCTTGATGAGG - Intergenic
974876983 4:67713349-67713371 GCAGAGACAAGAGCTTGCCTAGG + Intergenic
979550679 4:121987715-121987737 GCATGGTCATGTGCTAGCTTGGG - Intergenic
984441620 4:179778125-179778147 GCATGAATAGGAGCTTGAATAGG + Intergenic
984676730 4:182557530-182557552 GGATTGATAGGATCTTGCTTAGG - Intronic
990469669 5:56103487-56103509 TCATGAATAGGAGCTTGGTTGGG + Intronic
993782471 5:92084803-92084825 GCATGGAAAGGTGATTGCTGGGG - Intergenic
993859113 5:93112960-93112982 GAAGGGACAGGAGATTGCTTTGG - Intergenic
995504009 5:112839993-112840015 GCATTTACTGCAGCTTGCTTAGG - Exonic
997441171 5:133909560-133909582 GCATGCTCAGGAGTTTGCTTAGG + Intergenic
999576611 5:152985276-152985298 GGATGGGCAGCAGCTTGATTTGG + Intergenic
1000410474 5:160931811-160931833 GCATTGACTGAAGCTTTCTTTGG + Intergenic
1002347474 5:178557908-178557930 GCATGGACAGGGGTGTGCTGAGG + Intronic
1002895126 6:1374551-1374573 GAATGGAGAGGAGCTAGCTATGG - Intergenic
1003280001 6:4682970-4682992 GCAGGAACAGGAGCATGCGTGGG - Intergenic
1005227404 6:23658531-23658553 TGATGGACAGGAGTTTGCTGAGG - Intergenic
1005992833 6:30914200-30914222 GCATGCGCAGCAGCTGGCTTTGG - Intronic
1006502017 6:34465475-34465497 ACATGGCCTGGAGTTTGCTTTGG + Intergenic
1007263292 6:40578625-40578647 GCATGGAGAGGACCATACTTAGG - Intronic
1013171157 6:107637288-107637310 GCATAGCCAGGAGATTGCTTGGG + Intronic
1013430461 6:110050743-110050765 GCAGGGACCGGAGCCTGATTAGG + Intergenic
1014105336 6:117554565-117554587 GCATGGATAGGATTTTACTTAGG + Intronic
1014118835 6:117699567-117699589 GCATTGACTGCAGATTGCTTTGG - Intronic
1014888699 6:126815109-126815131 CCAGGGACTGGAGCTTGGTTGGG - Intergenic
1014900838 6:126963299-126963321 GCAAGGACAGCAGGTGGCTTGGG + Intergenic
1016651808 6:146470290-146470312 TCATGGACAGAAGCTTCCTCGGG + Intergenic
1017945546 6:159094034-159094056 GCATGGAGAAGAGCTGGCTCAGG + Intergenic
1019213675 6:170425778-170425800 GGATGGCCAGGAGCTTGTTCAGG + Intergenic
1024139856 7:46451365-46451387 GAAAGGAAAGGAGCTTGCTCAGG + Intergenic
1024930793 7:54665138-54665160 GCATGGACGGGAGAATGTTTAGG - Intergenic
1030094965 7:105890734-105890756 CCATGGAGAGCTGCTTGCTTTGG - Intronic
1031562232 7:123252396-123252418 GAAGGGACAGCAGCTTCCTTGGG + Intergenic
1032087825 7:128892989-128893011 GGATGGAGAGGAGTTTGCTGAGG - Exonic
1034353559 7:150433121-150433143 GCACGGAGAGGAGAGTGCTTGGG + Intergenic
1034832769 7:154324218-154324240 ACATGCACAGCAGGTTGCTTGGG + Intronic
1037689602 8:21171007-21171029 AGATGGACAGGAGGTTGCTAAGG - Intergenic
1040726113 8:50383762-50383784 GTATGCACAGGAGGTTCCTTAGG - Intronic
1042957680 8:74269222-74269244 GTATGAACATGAACTTGCTTGGG + Intronic
1046099838 8:109601683-109601705 GCATGGACAGGAGTTGACCTTGG + Intronic
1050115324 9:2257531-2257553 ACATGGTCAGGATGTTGCTTCGG - Intergenic
1050210022 9:3243746-3243768 GCCTTTACAGGTGCTTGCTTTGG - Intronic
1050432658 9:5577607-5577629 GCATGGTTATGTGCTTGCTTTGG - Intergenic
1057402884 9:94740125-94740147 GCATGGGCAGGAGCTTTTATTGG + Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059578032 9:115512909-115512931 GCATGAACAGGGCCTTGCTCAGG + Intergenic
1060181535 9:121537786-121537808 GCATGGACCGGACCTGGGTTGGG + Intergenic
1061367661 9:130180993-130181015 GGATGGACAGCAGCCTGCCTGGG + Intronic
1061492784 9:130955576-130955598 GAATGGAGTGGAGCCTGCTTTGG - Intergenic
1061596830 9:131636013-131636035 GGATGGACAGGAGCTGCCTGTGG - Intronic
1062443620 9:136584311-136584333 GCGTGGCCAGGGGCTTCCTTGGG + Intergenic
1187238916 X:17494867-17494889 CCATGGATAAGTGCTTGCTTTGG + Intronic
1188120239 X:26297136-26297158 GAATGATCAGGAGCTTGTTTTGG - Intergenic
1198821992 X:140658061-140658083 TCACGGACAGGGGCTTCCTTTGG + Intergenic