ID: 1151471158

View in Genome Browser
Species Human (GRCh38)
Location 17:74318700-74318722
Sequence CAGTGTGACCGGAGTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151471156_1151471158 -8 Left 1151471156 17:74318685-74318707 CCAACAGGGAGTCATCAGTGTGA No data
Right 1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG No data
1151471152_1151471158 29 Left 1151471152 17:74318648-74318670 CCGGAAGGAGGAAAGAAGCCGGT No data
Right 1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG No data
1151471153_1151471158 11 Left 1151471153 17:74318666-74318688 CCGGTGCTGCTCTGTTAGACCAA No data
Right 1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151471158 Original CRISPR CAGTGTGACCGGAGTGAGTA AGG Intergenic
No off target data available for this crispr