ID: 1151473355

View in Genome Browser
Species Human (GRCh38)
Location 17:74331394-74331416
Sequence GGCCACCGTGAGGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151473339_1151473355 24 Left 1151473339 17:74331347-74331369 CCTGAGTGGGGAGAGGTGGACCG 0: 1
1: 0
2: 1
3: 19
4: 215
Right 1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG 0: 1
1: 0
2: 4
3: 13
4: 188
1151473343_1151473355 4 Left 1151473343 17:74331367-74331389 CCGGGGACACAGTAACCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG 0: 1
1: 0
2: 4
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151473355 Original CRISPR GGCCACCGTGAGGGGTCCTG GGG Intronic
900522492 1:3112519-3112541 GGCCACTGAGCGGGGCCCTGGGG - Intronic
902447799 1:16478190-16478212 GGGCACTGTCAGGGGACCTGAGG + Intergenic
911019679 1:93374310-93374332 GGACACCATGAGGAGTCCTGAGG - Intergenic
915315568 1:155026849-155026871 GGGCACCATGAGGGTGCCTGAGG - Intronic
915740031 1:158112338-158112360 GGCCACAGAAAGGGGTACTGAGG - Intergenic
917457705 1:175199781-175199803 GACCACCTGGAGGGGTGCTGTGG + Intergenic
922917220 1:229268774-229268796 GCCCAACGTGAGGAGCCCTGGGG - Intergenic
923745079 1:236692712-236692734 GGACACCGTGATGTGTCCCGGGG + Intronic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1068167445 10:53349750-53349772 GGCAAACATGAGGGATCCTGTGG + Intergenic
1071467162 10:85951717-85951739 GGCCAGCGAAAGGGATCCTGGGG - Intronic
1072211986 10:93254452-93254474 GGCCACCGGCAGGGGCCCTATGG + Intergenic
1073241946 10:102065150-102065172 GGCCACTGGGCGGCGTCCTGGGG + Intergenic
1074770023 10:116727333-116727355 GGCCACCTAGAGGGGAACTGAGG - Intronic
1074823913 10:117201300-117201322 GGCCACCGTGAGGGGGACTGTGG - Intronic
1076305164 10:129461105-129461127 GCCCACCGTGATTGGTCCAGAGG + Intergenic
1076402595 10:130193669-130193691 CGCCATGGTGAGGAGTCCTGCGG - Intergenic
1076864301 10:133159787-133159809 GGGGACCCTGGGGGGTCCTGGGG - Intergenic
1077317184 11:1924840-1924862 GGCCCCTGAGAGGGGTTCTGAGG - Intronic
1077390980 11:2300491-2300513 GGGCACAGTGAGGGGGGCTGTGG + Intronic
1077488013 11:2847983-2848005 GGCCCCGATGAGGGGTCCTGAGG + Exonic
1078325302 11:10375742-10375764 GGCCAGCGTTAGGAGCCCTGGGG - Intronic
1082749581 11:57001968-57001990 GGCAAAAGTGAGAGGTCCTGGGG + Intergenic
1083632650 11:64103784-64103806 GGCCACCCTCGGGAGTCCTGGGG + Exonic
1083671036 11:64300061-64300083 GGCCACCGTGGGGGCACCTCTGG + Intergenic
1084053416 11:66616122-66616144 GAGCACCGCGAGGGGACCTGAGG - Intergenic
1084408426 11:68992155-68992177 CCCCACCGGGAGGGGTCCTCTGG - Intergenic
1085386213 11:76159778-76159800 GAGCACCTTGGGGGGTCCTGGGG - Intergenic
1087685076 11:101253366-101253388 GGGCAGCGTGAGGGCACCTGGGG + Intergenic
1090965291 11:131592807-131592829 GGCCAGGGAGAGGGGACCTGGGG - Intronic
1091347667 11:134866231-134866253 AACCAGCCTGAGGGGTCCTGCGG + Intergenic
1097249947 12:57626978-57627000 GTACACAGTGAGGGATCCTGAGG + Intronic
1099064712 12:77960067-77960089 GGCCATGGTGTGAGGTCCTGGGG + Intronic
1101998004 12:109538881-109538903 GGGCACAGTGAGGTGCCCTGAGG - Intergenic
1104964367 12:132502370-132502392 GGCCACCCAGAGGAATCCTGCGG + Intronic
1105574816 13:21640481-21640503 AGCCACCGGGAGCCGTCCTGTGG - Intergenic
1106768979 13:32943764-32943786 GGCCAACGTGAGGAGTTCAGGGG + Intergenic
1112781062 13:102901941-102901963 GGGCACAGTGAGGGCTTCTGAGG + Intergenic
1113806356 13:113111941-113111963 GACCTCTGTGAGGTGTCCTGTGG - Intronic
1113806387 13:113112158-113112180 GACCTCTGTGAGGTGTCCTGTGG - Intronic
1113806442 13:113112589-113112611 GACCTCTGTGAGGTGTCCTGTGG - Intronic
1113806453 13:113112653-113112675 GACCTCTGTGAGGTGTCCTGTGG - Intronic
1115197784 14:30820333-30820355 GGTCAGAGAGAGGGGTCCTGGGG - Intergenic
1119642284 14:76324336-76324358 GGACCCCATGAGGGCTCCTGTGG + Intronic
1121949325 14:98156677-98156699 GGCAACCGTGGGGGGGCCGGTGG - Intergenic
1123401973 15:19996232-19996254 GGCCAACGTACTGGGTCCTGGGG - Intergenic
1123511314 15:21002896-21002918 GGCCAACGTACTGGGTCCTGGGG - Intergenic
1128075412 15:64822594-64822616 GGCCACCTTGGGGCTTCCTGGGG + Exonic
1129246543 15:74282409-74282431 GGCCATTGTGAGGGGGCATGTGG - Intronic
1129871438 15:78944309-78944331 GGCCAACAAGAGGAGTCCTGGGG + Intronic
1132706996 16:1249093-1249115 GTCCCCCGGGAGGGGGCCTGGGG - Intergenic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1135389255 16:22075481-22075503 GCCCACAGTGAGTGCTCCTGGGG - Exonic
1135401421 16:22168985-22169007 GGCCGCTGTGAGGGCTCCTGTGG - Intronic
1138113525 16:54342629-54342651 GGCCACCTAGAGGGGTCATGGGG + Intergenic
1140715604 16:77722903-77722925 TGCCACTGTCGGGGGTCCTGGGG - Intronic
1141435254 16:83996218-83996240 AGCATACGTGAGGGGTCCTGGGG - Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1144422781 17:15113183-15113205 GGCCACAGTGAGGGCCCCAGGGG + Intergenic
1145014581 17:19387862-19387884 GGCCAGAGTGAGGGGGGCTGGGG - Intergenic
1147904314 17:43813059-43813081 GGCTACTGAGAGGGGTGCTGTGG - Intronic
1147925050 17:43941001-43941023 GGCCAGCCTGAGGCCTCCTGAGG - Intronic
1148145458 17:45361807-45361829 GGGCACTGTGAGGGGTACGGAGG - Intergenic
1148866073 17:50629366-50629388 GGCCACAGAGAGGGCTGCTGGGG - Intergenic
1149475975 17:56961058-56961080 GGCCACCGAGAGGCGTGCTCGGG + Intergenic
1150795783 17:68235594-68235616 AGGCACCGAGAGGGGCCCTGAGG - Intergenic
1150891357 17:69153915-69153937 GGCCACAGTGAGTTCTCCTGAGG + Exonic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1151714332 17:75823738-75823760 GGCCGCCCTCAGGGGTGCTGGGG - Intronic
1151898242 17:76994829-76994851 GGCCACCTTGAGGGGTTCTGGGG + Intergenic
1152460899 17:80441843-80441865 GGCCACAGTGAGGGGTTCAGGGG - Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1153027845 18:687564-687586 TGCCACCGTGAGCTGTGCTGAGG + Intronic
1153872490 18:9334258-9334280 GGCAGCTGTGAGGAGTCCTGAGG + Intergenic
1154390358 18:13931535-13931557 AGCCACCAGCAGGGGTCCTGGGG + Intergenic
1155365716 18:25047443-25047465 GGCCAGTGTGTGGGCTCCTGTGG + Intergenic
1159284973 18:66337001-66337023 GGCCACCAAGCGGAGTCCTGAGG - Intergenic
1159856842 18:73598920-73598942 GGCCACAGTGTGGGCTCCCGAGG - Intergenic
1160239484 18:77112812-77112834 GGCCACCTTCACAGGTCCTGGGG - Intronic
1160443849 18:78912588-78912610 GGACTCCATGAGGGTTCCTGTGG + Intergenic
1160726466 19:619871-619893 GGCCAAGGTGAGGGCACCTGGGG + Intronic
1161048824 19:2151376-2151398 GGGCGCCGTGAGGGGGCCCGGGG + Exonic
1162528513 19:11221917-11221939 GGCCACTGTGAAGGCTCGTGTGG - Exonic
1162823407 19:13236727-13236749 GGCCACCCAGGGAGGTCCTGGGG - Intronic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165382376 19:35490355-35490377 AGCCACCCTGGGTGGTCCTGAGG - Exonic
1165403733 19:35617849-35617871 GGTCATCATGAGGGGTTCTGTGG - Exonic
1166050714 19:40257200-40257222 GGCCACCTGGAGGGCTCCTCTGG - Intronic
1166750877 19:45163484-45163506 GGCCCCCATGAGTGGGCCTGGGG + Intronic
1167055988 19:47112073-47112095 GGGCGCCGTGGGGGGTGCTGCGG - Intronic
1168354020 19:55691253-55691275 GGGCATCGTGAGGGGTGCTCAGG + Intronic
925356637 2:3246691-3246713 GGCTACAGGGAGGAGTCCTGTGG - Intronic
927152457 2:20203860-20203882 TGCCACCGAGAGGGCTGCTGAGG - Exonic
928495685 2:31829274-31829296 GGCCACCGGGCAGAGTCCTGAGG - Intergenic
929667112 2:43841649-43841671 GGCCACAGTGAAGGGGCTTGGGG + Intronic
930541377 2:52711268-52711290 GGCCAGTGTGAGGGGCCCTGAGG - Intergenic
930555995 2:52896311-52896333 GGGCACCGTGAGGCATTCTGGGG - Intergenic
930574319 2:53127444-53127466 GGCCACTGTGAGGGATCGGGAGG + Intergenic
931427401 2:62183769-62183791 GGGCACAGTGAGGGGTGATGAGG - Intergenic
931603349 2:64026627-64026649 AGCCACAGTCAGGGGCCCTGCGG - Intergenic
933990690 2:87632162-87632184 GGCCACTGTCAGGGACCCTGGGG + Intergenic
936303154 2:111318661-111318683 GGCCACTGTCAGGGACCCTGGGG - Intergenic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937323159 2:120972968-120972990 GGCCACCATGAGAGGGCTTGGGG - Intronic
937768685 2:125693845-125693867 GGTCACCTTGAGGGATCGTGGGG + Intergenic
937888392 2:126916047-126916069 GGTCTCCGTGAGGGCTCCTCTGG + Intergenic
938321843 2:130371266-130371288 GCCCACCAGGAGGGGTCCTCAGG + Exonic
938592246 2:132750908-132750930 GGTCTCCCTGTGGGGTCCTGAGG + Intronic
938613135 2:132969689-132969711 GGCCACTTTGAATGGTCCTGGGG + Intronic
939862540 2:147436893-147436915 GGCCACCGAGGGGAGTTCTGGGG - Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
946306800 2:218860755-218860777 CGGGACCGGGAGGGGTCCTGCGG + Intronic
946767429 2:223053347-223053369 AGCCACCGGCAGGGGTCCCGGGG - Exonic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
948096083 2:235334862-235334884 GCCCACCGTGAGGGCTGTTGTGG - Intergenic
948373518 2:237505453-237505475 AGCCTGCATGAGGGGTCCTGTGG - Intronic
1168957781 20:1846586-1846608 GGCCACAGTGAGGTGCCATGGGG + Intergenic
1170736965 20:19021113-19021135 GGCCACAGGGAGGTGACCTGGGG + Intergenic
1171400683 20:24871553-24871575 CGCCTCCATGTGGGGTCCTGAGG - Intergenic
1176860278 21:14008157-14008179 GGCCACCCTGATGGTGCCTGTGG + Intergenic
1178786253 21:35656496-35656518 GGCCACAGTCACAGGTCCTGAGG - Intronic
1180920630 22:19519805-19519827 GGCCACCCTGAGAGGAACTGTGG - Intronic
1184451196 22:44583877-44583899 GGCCATCGTGGGGGGTGCAGAGG - Intergenic
1185100174 22:48836125-48836147 TGCCAGCGTGGGGGGACCTGTGG + Intronic
1185374484 22:50475681-50475703 GGGCACTGTCAGGGATCCTGGGG - Intergenic
950098952 3:10345755-10345777 GGCCAGGGTGAGGCTTCCTGAGG - Intronic
952557680 3:34551473-34551495 TGCCGCCGTGAGTGGTCCAGTGG + Intergenic
953389367 3:42525717-42525739 GGGCACCGTGGGGGCACCTGGGG - Intronic
953545765 3:43862705-43862727 GGCAGCGGTGAAGGGTCCTGAGG + Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
954756614 3:52843834-52843856 GGCCACCGAGAGTGTGCCTGGGG + Intronic
955073275 3:55589581-55589603 GGCCTCCATGAGGAGTCCTTGGG + Intronic
955351571 3:58197345-58197367 GGCCACCGCATAGGGTCCTGTGG + Intronic
955911359 3:63863215-63863237 TGACACCAGGAGGGGTCCTGGGG - Intronic
961327978 3:126121558-126121580 GGCCAGCTTGAGGAGCCCTGCGG + Intronic
966897439 3:184456382-184456404 GGGCACCGTCAGGGGTCGTCAGG + Intronic
967884773 3:194325879-194325901 GGCCACACAGAGGGGGCCTGTGG + Intergenic
969518862 4:7664202-7664224 GGCCACCGTGATGACACCTGCGG - Intronic
969530357 4:7726999-7727021 GGTCACCCTGAGTGGCCCTGGGG + Intronic
969827976 4:9773182-9773204 GGCCACCATCAGGGGTCCTGTGG + Intronic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
975202818 4:71611101-71611123 GCCCACCTTGAGGGATTCTGTGG + Intergenic
984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG + Intronic
988201702 5:28077606-28077628 GGCCACCGTGTGGGATCCACTGG - Intergenic
988608567 5:32703675-32703697 GGCCACCAAAAGGAGTCCTGAGG - Intronic
991550614 5:67831828-67831850 GGGGACGGTTAGGGGTCCTGGGG + Intergenic
997596019 5:135107953-135107975 GGCCACCCTTGAGGGTCCTGCGG + Intronic
998530621 5:142881121-142881143 GGCCACCAAGAGGAGCCCTGCGG - Intronic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1001858323 5:175031991-175032013 GGCCACTGAGAAGGCTCCTGTGG - Intergenic
1002638358 5:180619093-180619115 GATCACCATGAGGGGGCCTGCGG + Exonic
1002932961 6:1646956-1646978 GACCACCTTGATGGCTCCTGTGG + Intronic
1003675601 6:8201776-8201798 GGGCACCATGCGGAGTCCTGAGG - Intergenic
1006163780 6:32052947-32052969 GGCCTCCGTGCTGGGTTCTGTGG + Intronic
1007426583 6:41749923-41749945 CACCACCATGAGGGGACCTGAGG - Intronic
1012620606 6:101339677-101339699 GGGCACCGAGAGGGTTCTTGGGG - Intergenic
1015281669 6:131441359-131441381 GGCCATCATAAGGGGTCCAGAGG - Intergenic
1016372860 6:143392642-143392664 GGCCACATTGTGGGGTACTGGGG + Intergenic
1018584314 6:165338925-165338947 AGCCACAGTGAGGAATCCTGAGG - Intronic
1018842869 6:167531181-167531203 GGCCACCGTCAGAGCACCTGCGG - Intergenic
1018923733 6:168193061-168193083 GGGCGCCGCGTGGGGTCCTGCGG + Intergenic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019321234 7:416249-416271 GGACACTGTGAGGTCTCCTGGGG - Intergenic
1019334496 7:476604-476626 GGTCACATTCAGGGGTCCTGGGG - Intergenic
1019505476 7:1388409-1388431 GGACACAGTGAGGGGTGCTGTGG - Intergenic
1019716423 7:2541462-2541484 GGCCACGGTGAAGGGCGCTGGGG + Exonic
1021862631 7:24922270-24922292 GGGCACAGTGAGGGGGACTGGGG + Intronic
1023617846 7:42038584-42038606 GTGCACAGGGAGGGGTCCTGGGG - Intronic
1024117807 7:46209763-46209785 GAGCACTGTGGGGGGTCCTGAGG - Intergenic
1024994568 7:55261916-55261938 GGCCACCTTGTGGGGATCTGTGG - Intergenic
1027202639 7:76073182-76073204 GGCCACCGTGAGGCGTCAGCTGG + Intergenic
1029488761 7:100858982-100859004 TGCCACCGTGAGGGACCCAGGGG + Intronic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1034937496 7:155209495-155209517 GGCCAGGATGGGGGGTCCTGGGG - Intergenic
1035400084 7:158558991-158559013 GGCCACACTGGGGGGTCCAGAGG + Intronic
1035404136 7:158587440-158587462 CGCCACCCTGAGGGGTCGGGGGG - Intronic
1035676976 8:1462807-1462829 CGCCGCCGTGTGGGGGCCTGAGG - Intergenic
1037610234 8:20469871-20469893 GGTCAGCGTGAGGGGTGCTAGGG + Intergenic
1037823694 8:22148125-22148147 GGCCACCCTGAGGAGACCAGAGG + Exonic
1038632923 8:29262892-29262914 GGCCGCCGTGGGGGGTCCGGCGG - Intronic
1040387017 8:46920774-46920796 GGCCATCGGGAGTGGTCATGGGG - Intergenic
1045313743 8:101026126-101026148 GGCCATCGTGAGGGCTTCTCTGG - Intergenic
1045966300 8:108028649-108028671 GGCCTCCATGTGGAGTCCTGTGG + Intronic
1049344442 8:142130874-142130896 GGGCCCTGTGAGGAGTCCTGCGG - Intergenic
1049526037 8:143127494-143127516 GGCAACAGTGAGGGGCCCAGCGG + Intergenic
1049575196 8:143386602-143386624 GGCAGCCGGGAGGGGCCCTGAGG + Intergenic
1049579685 8:143405622-143405644 GGTCCCAGTGAGGGGTCCTCGGG - Intergenic
1049749517 8:144276673-144276695 GGCCCCTGGGAGGAGTCCTGTGG - Intronic
1049820415 8:144629945-144629967 GGACACTGTGGGGGGCCCTGGGG + Intergenic
1049844607 8:144793672-144793694 GGGCAGGGTGAGGGGTTCTGGGG + Intergenic
1053273026 9:36763059-36763081 GGCCACCCTGACGGGCCATGTGG - Intergenic
1057584223 9:96315087-96315109 TGGCAGCGTGAGGAGTCCTGTGG - Intergenic
1060431193 9:123552560-123552582 GCCCACCATGCAGGGTCCTGGGG - Intronic
1060488642 9:124065619-124065641 GGTCACCCAGAGGGGGCCTGGGG - Intergenic
1061008029 9:127939315-127939337 GGCCTCCCTGAGGGGTTATGTGG + Intergenic
1061282539 9:129605787-129605809 AGCTGCCCTGAGGGGTCCTGGGG + Intergenic
1061540725 9:131276875-131276897 GGCCGCCGTGCAGGGTCCCGGGG + Intergenic
1062275773 9:135729900-135729922 GGCCACCTTGAGGTGACCAGGGG - Intronic
1062368394 9:136223104-136223126 GTCCACTGTGAGGGGCCTTGCGG - Intronic
1062616075 9:137396472-137396494 GGCCACCGTGAGGGCTGCCTGGG - Intronic
1190984547 X:55489062-55489084 GGCCGATGGGAGGGGTCCTGGGG - Intronic
1194097888 X:89665963-89665985 GTGCACCGCCAGGGGTCCTGAGG - Intergenic
1198394283 X:136206970-136206992 GGCCACCATGAGGGGTGCTGGGG - Intronic
1200230349 X:154440855-154440877 GGCCAGCGGGAGGGGGCATGAGG - Intronic
1200450910 Y:3327352-3327374 GTGCACCGCCAGGGGTCCTGAGG - Intergenic