ID: 1151474914

View in Genome Browser
Species Human (GRCh38)
Location 17:74339845-74339867
Sequence GGTCCAAAGGGACCTCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151474905_1151474914 21 Left 1151474905 17:74339801-74339823 CCGCGGTGCAGTGGTTGGGGGTG 0: 1
1: 0
2: 5
3: 17
4: 182
Right 1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
1151474902_1151474914 24 Left 1151474902 17:74339798-74339820 CCTCCGCGGTGCAGTGGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151474914 Original CRISPR GGTCCAAAGGGACCTCAGGC AGG Intronic
900255777 1:1697695-1697717 GGTCCAAAGGGGCTGCAGCCAGG - Intronic
900264448 1:1750305-1750327 GGTCCAAAGGGGCTGCAGCCAGG - Intergenic
903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG + Intergenic
903822013 1:26110791-26110813 GGTCCTAAGTGACCCCGGGCTGG + Intergenic
904351018 1:29906793-29906815 GGGCCGAGGAGACCTCAGGCTGG - Intergenic
904356727 1:29945054-29945076 GGTCAAAAGTGGCCCCAGGCGGG + Intergenic
906301422 1:44684800-44684822 CTTGCACAGGGACCTCAGGCAGG + Intronic
906320947 1:44815043-44815065 GGTAAAAAGAGACCTAAGGCAGG - Intronic
907225259 1:52940299-52940321 GGTGCAAAGGGAGCTGAGGTGGG + Intronic
912452296 1:109774483-109774505 GGTCCAAAGGGACTTCCAGTGGG + Intronic
916249151 1:162719568-162719590 GGTCCTGTGGGATCTCAGGCAGG + Intronic
917441901 1:175075826-175075848 GGTGGAAAGGCACCTCAGACAGG - Intronic
917649923 1:177066237-177066259 GTTCCCACTGGACCTCAGGCTGG + Intronic
920880645 1:209877231-209877253 GGTACAAGGGGCCCTCAGGGAGG + Intergenic
922869488 1:228890427-228890449 GGTAGAAAGTGCCCTCAGGCTGG + Intergenic
1063714348 10:8513034-8513056 GTTCAAAGGGGACCTCAGGTGGG - Intergenic
1065705548 10:28468884-28468906 GGTGCACAGGGACCTCAAGGTGG + Intergenic
1074393954 10:113081678-113081700 GGTTCAATGTGACCTCAAGCAGG - Intronic
1074565177 10:114571235-114571257 AGTCCAGAGGTAGCTCAGGCAGG - Intronic
1074769413 10:116723711-116723733 GGTCCTCATGGTCCTCAGGCTGG - Intronic
1076030684 10:127155478-127155500 GTTCCAAAGGCACCTCATGTGGG - Intronic
1076641478 10:131919691-131919713 TGTTTATAGGGACCTCAGGCCGG + Intronic
1077041879 11:528422-528444 GCTGCTAGGGGACCTCAGGCAGG + Intergenic
1077377006 11:2209809-2209831 GAGACAGAGGGACCTCAGGCAGG - Intergenic
1077466042 11:2734243-2734265 GGTCCTAAGAGGCCTCAGGCCGG + Intronic
1083262463 11:61530682-61530704 GGACCAGAGGGACCTCAGGTGGG - Intronic
1083955828 11:65982311-65982333 GGTCCACAGGGAGCCCATGCTGG - Intergenic
1084446015 11:69204234-69204256 GGTCCAAAGGGATCTCAGGTGGG + Intergenic
1085284270 11:75349953-75349975 GGTCAAAAGGGGCCAGAGGCAGG - Intronic
1087704718 11:101477248-101477270 GGTCTCAAGGGCTCTCAGGCAGG - Intronic
1090264056 11:125343032-125343054 GTTCCAAGGGGGCCACAGGCTGG + Intronic
1092273395 12:7040740-7040762 GGGCCACAGGGACTTCAGGAAGG + Intronic
1096841143 12:54379723-54379745 GGGCAAAAGCGACCTCAGACTGG + Intronic
1102742365 12:115219301-115219323 GATCCTAAGGGACCACAGTCTGG + Intergenic
1103319199 12:120080797-120080819 GGAACAAAGAGACCCCAGGCAGG - Intronic
1103794589 12:123494586-123494608 GGCCCCACGGGAGCTCAGGCTGG - Intronic
1104591640 12:130088618-130088640 CGTCAAAAAGGACCACAGGCTGG + Intergenic
1106133430 13:26958014-26958036 TGCCCAAAGGGTGCTCAGGCAGG - Intergenic
1121262944 14:92579848-92579870 ACTGCAAAGGGACCTCTGGCTGG + Intronic
1121332499 14:93058358-93058380 GGTCCACAGGGTCATAAGGCAGG + Intronic
1121529901 14:94644874-94644896 GGGGCAGAGGGACCCCAGGCAGG + Intergenic
1122489752 14:102106512-102106534 GCTCAACAGGGAGCTCAGGCGGG - Intronic
1122873337 14:104651300-104651322 GGTCTGGAGGGCCCTCAGGCTGG + Intergenic
1122920554 14:104878201-104878223 GGCCCCATGTGACCTCAGGCTGG - Intronic
1133045539 16:3086610-3086632 GGGCCAAAGTCCCCTCAGGCCGG - Intergenic
1136536565 16:30903081-30903103 AGGCCAAAGGGAACTGAGGCAGG - Exonic
1137628790 16:49927657-49927679 GGTCCACTGGGACCTCAGTAGGG + Intergenic
1141965230 16:87437591-87437613 GGGGCAAAGGGACCCGAGGCTGG + Intronic
1142993250 17:3745995-3746017 GGCCACAAGGAACCTCAGGCAGG - Intronic
1143099999 17:4499529-4499551 GGTCCGTAGGGACCTCACGTAGG - Intronic
1145003331 17:19320870-19320892 GGACCCACAGGACCTCAGGCTGG - Intronic
1145907397 17:28524035-28524057 GCGCCAAGGGGACCTCATGCAGG + Exonic
1145924087 17:28633023-28633045 GGCCCAAGGGCACCTCAGGCAGG + Exonic
1146374325 17:32284237-32284259 GGGCCAGAGGGACCCCAGGGGGG - Intronic
1146452314 17:32984378-32984400 GGTCAGAAGAGTCCTCAGGCTGG - Intronic
1149644785 17:58232453-58232475 GGTCCACAGGGACTTCAGAGAGG + Intronic
1150220872 17:63495307-63495329 GGGCTAGAGAGACCTCAGGCTGG + Intronic
1150414095 17:64973369-64973391 GGTCCAAAGAGATCACTGGCTGG + Intergenic
1150797540 17:68250314-68250336 GGTCCAAAGAGATCACTGGCTGG - Exonic
1151001635 17:70383173-70383195 TTTCCTAAGGGAACTCAGGCTGG + Intergenic
1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG + Intronic
1163360992 19:16846495-16846517 GGACCAAAGGGAACCCAGGTTGG - Intronic
1164797875 19:31049561-31049583 AGTCCAAAGGAACTTCAGACTGG - Intergenic
1164869494 19:31631462-31631484 GGTTCACAGGGAGCTCACGCTGG + Intergenic
1165723173 19:38093903-38093925 GTGCCAAAGGGACCTGAGACAGG - Intronic
1168035648 19:53717360-53717382 ATTTAAAAGGGACCTCAGGCTGG + Intergenic
1168688761 19:58364158-58364180 GGTCCAAAGTGACCACTGCCAGG - Intergenic
924965147 2:69627-69649 GGCCCAAAGCAACCTCAGGCAGG - Intergenic
925344498 2:3161057-3161079 GTTGCACAGGGTCCTCAGGCAGG + Intergenic
925895747 2:8470790-8470812 GGTCCAAAATGTGCTCAGGCAGG + Intergenic
927488256 2:23503993-23504015 GGCCCTCAGGGACCTCTGGCTGG - Intronic
929151033 2:38749610-38749632 GGATCAAAGGGACGTCGGGCAGG + Exonic
935592590 2:104855726-104855748 GGTCCAGAGCGACTTCATGCAGG + Exonic
938337110 2:130510219-130510241 GTGTCAAAGGCACCTCAGGCAGG - Intergenic
938352727 2:130610512-130610534 GTGTCAAAGGCACCTCAGGCAGG + Intergenic
938849684 2:135247990-135248012 GGTCCAAAGGCACCTGAAGGAGG - Intronic
941185601 2:162318448-162318470 TGTCCACAGGGCTCTCAGGCCGG + Exonic
941433154 2:165435969-165435991 GGACCAAAGGGAGCTCCTGCTGG - Intergenic
945648379 2:212530184-212530206 GGTCCTTAGAAACCTCAGGCAGG - Intronic
946016466 2:216608007-216608029 GCTCCAAGGGGGCCTCAGGGTGG - Intergenic
946136756 2:217653886-217653908 GGTCTAATGGGATCTCAGGTAGG - Intronic
947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG + Intergenic
948205727 2:236161910-236161932 GATCCAAAGGCTCCTGAGGCCGG + Intergenic
948781084 2:240322366-240322388 AGGGCAAAGGGACCTCAGCCCGG + Intergenic
948992618 2:241562493-241562515 CGTCCCATGGGACCTCAGGGAGG + Intronic
1169171735 20:3470977-3470999 GGTCCAAAGGGGCCACAGCGGGG - Intergenic
1173166395 20:40689573-40689595 GGTGCAAAGGGAACTGAGGGAGG - Intergenic
1173237120 20:41256765-41256787 GGTGCAAAGGGACAGCAGACGGG - Intronic
1175818868 20:61897776-61897798 GGTTCCAGGGGGCCTCAGGCAGG + Intronic
1175888468 20:62305340-62305362 GCTCCACAGAGACCTCAGCCAGG - Intronic
1177965589 21:27722536-27722558 GGTCCAAAGGAGACACAGGCAGG + Intergenic
1178584304 21:33859821-33859843 GATCCAAGGTGACATCAGGCAGG + Intronic
1181908094 22:26215723-26215745 GATCCAAACCCACCTCAGGCTGG - Intronic
1183140555 22:35934604-35934626 GGTCCTAAGGCTCCTAAGGCTGG - Intronic
1184652268 22:45924811-45924833 GGCCCAAAGGCTCATCAGGCGGG + Intronic
1184652337 22:45925029-45925051 GGTCCAAAGGCTCATCAGGTGGG + Intronic
949925459 3:9037633-9037655 GGTACATGGGGACCTCAGGCTGG + Intronic
952741240 3:36737219-36737241 TGTCCACCGGGACCTCAAGCCGG - Exonic
953026560 3:39148504-39148526 GGTCCTGGGGGATCTCAGGCTGG - Intronic
953563812 3:44014281-44014303 TCTGCAAAGGGATCTCAGGCTGG - Intergenic
953572051 3:44078960-44078982 GGTGCAGAGGGACCTGAGGCAGG - Intergenic
954107022 3:48414954-48414976 GGACCCAGGGGTCCTCAGGCAGG + Exonic
954139190 3:48596154-48596176 GGCCCAAGGGGACCTCGGCCTGG - Intergenic
954464644 3:50647247-50647269 GGGCAAAAGGGACTTCAGGGGGG + Intronic
955103968 3:55878244-55878266 AGTCAAAAGGGACTTCAGCCTGG - Intronic
955752465 3:62196667-62196689 GATCCAAGAGGACCTCAGGCTGG - Intronic
956681601 3:71786008-71786030 GGGCTTAAGGGGCCTCAGGCTGG - Intergenic
957048318 3:75393488-75393510 AGTCCACAGGGACCTCTGCCTGG + Intergenic
961184678 3:124904284-124904306 GGTCCAAAGGGGGATCAGGAAGG + Intergenic
961392244 3:126559015-126559037 GGGCCAGAGGGGCTTCAGGCTGG - Intergenic
961445447 3:126978902-126978924 GTTCCAAAGTGGGCTCAGGCAGG + Intergenic
962317176 3:134366141-134366163 GCTCCAAAGGGGTCTCAGCCTGG + Intronic
970115938 4:12695627-12695649 GGACCAGAGGGACTTCATGCTGG - Intergenic
985903295 5:2813784-2813806 GGTACAGAGGGACCCCAAGCAGG - Intergenic
987807784 5:22792383-22792405 AATCAAAAGGGAGCTCAGGCCGG - Intronic
992715899 5:79510995-79511017 TGTACAAAGAAACCTCAGGCAGG + Intronic
995233283 5:109795833-109795855 GGTCAACAGAGACCTTAGGCAGG - Intronic
995560792 5:113379092-113379114 GGTCCTCAGGGACTTGAGGCAGG - Intronic
999193262 5:149764314-149764336 GGACCAGAGGGACCTCAGCCCGG + Intronic
1001302204 5:170541793-170541815 GGTGCAAATGGACCTCAGAGAGG - Intronic
1001489390 5:172144912-172144934 AGTCCCAAGGCACCTCAGGATGG + Intronic
1002077927 5:176720339-176720361 GGTCAAAAGGAACCTCTGCCGGG - Intergenic
1002205191 5:177557912-177557934 GTTCCACACGGACCTCTGGCTGG - Intergenic
1002423526 5:179162875-179162897 GGACCACAGGGACCCCAGTCAGG + Intronic
1004806157 6:19205682-19205704 GGACCAAAGGGTGCTCAGGTTGG + Intergenic
1006505789 6:34487839-34487861 GGTCAAAAGTGACCTCACCCTGG + Intronic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1013626315 6:111940746-111940768 TGCCCAAAGGGAGCTCTGGCAGG + Intergenic
1014438116 6:121442748-121442770 GGGCCAGAGGAGCCTCAGGCTGG + Intronic
1015933560 6:138386031-138386053 GCTCCTCAGGGACCTGAGGCAGG - Intergenic
1017902023 6:158726654-158726676 GGTCCAAAGAGATCACTGGCTGG + Intronic
1018611001 6:165647735-165647757 CGTCCAAAGGGGCTTCAGTCGGG - Intronic
1022736861 7:33084227-33084249 AGTCCAAAGAGTCATCAGGCAGG + Intergenic
1023704712 7:42929641-42929663 GGTCCAAAGGTAACTTTGGCTGG - Intronic
1026153140 7:67804778-67804800 TGCCCAAAGGAACCTCAGCCAGG - Intergenic
1026258003 7:68729476-68729498 GGTCCACAGGGCCCACGGGCAGG + Intergenic
1026277106 7:68889580-68889602 GGTCCATGTGGACCTAAGGCAGG - Intergenic
1026979873 7:74519872-74519894 GGTCCAAGGGGGTCTCAGCCAGG - Intronic
1032165023 7:129538695-129538717 GCTCCAGAGGGATCTCAGGCAGG + Intergenic
1033635871 7:143210605-143210627 AATCCAAAGGGTCCTTAGGCAGG + Intergenic
1034908791 7:154974588-154974610 GGTCAAGAAGGACCTCGGGCAGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1037776824 8:21841038-21841060 GGTTCAGAGGGGCTTCAGGCTGG + Intergenic
1038781634 8:30573208-30573230 GGACCAAAGGCAGATCAGGCGGG - Intergenic
1047900434 8:129415614-129415636 AGTCAAAAGGGAACTCATGCAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1057273964 9:93666338-93666360 GCCCCAGAGGGACCTCAGGCTGG - Intronic
1057517866 9:95737159-95737181 GGTTCTCAGGGACCTCAGCCAGG + Intergenic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1058229781 9:102411276-102411298 GGTCCAAAGGGAGCCCCTGCTGG - Intergenic
1058560203 9:106220423-106220445 GGTCCTAAGGGACATGAGGTTGG + Intergenic
1059735145 9:117093009-117093031 GGTGCAAAGGAACCTGAAGCTGG + Intronic
1059807836 9:117823259-117823281 GGTGCAATGGGACATCAGACTGG + Intergenic
1060895492 9:127214576-127214598 GGTCCAAAGAGACCACTGGAGGG + Intronic
1061064929 9:128271678-128271700 GTTCCAAATGGACTCCAGGCTGG - Intronic
1061421436 9:130474862-130474884 GGTCCATAGAGGCATCAGGCTGG + Intronic
1185925631 X:4142677-4142699 GGTCCACCTGGAGCTCAGGCTGG - Intergenic
1191861856 X:65672112-65672134 GATACAAAGGGACCTAAGACAGG - Intronic
1198120895 X:133591470-133591492 GGGCCCAAGGAACTTCAGGCTGG + Intronic
1200269922 X:154673276-154673298 GGTCCAATGAGACCACTGGCTGG + Intergenic
1200703260 Y:6420198-6420220 GAACCAAAGTGACCTCAGGTAGG - Intergenic
1200918663 Y:8593653-8593675 GGTCCATGGGGAACACAGGCAGG - Intergenic
1201030850 Y:9744509-9744531 GAACCAAAGTGACCTCAGGTAGG + Intergenic
1202177960 Y:22114990-22115012 GAGCCAAAGGGACTTCAGGTGGG - Intergenic
1202180834 Y:22138544-22138566 GGGCAAAAGGGACTTCGGGCAGG - Intergenic
1202210526 Y:22447856-22447878 GGGCAAAAGGGACTTCGGGCAGG + Intergenic
1202213401 Y:22471405-22471427 GAGCCAAAGGGACTTCAGGTGGG + Intergenic