ID: 1151478812

View in Genome Browser
Species Human (GRCh38)
Location 17:74358065-74358087
Sequence CCTTCTCCTTGCCATGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151478802_1151478812 19 Left 1151478802 17:74358023-74358045 CCTGCCTTTGGGGTTTCCAGTCT 0: 1
1: 0
2: 1
3: 57
4: 369
Right 1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 208
1151478804_1151478812 15 Left 1151478804 17:74358027-74358049 CCTTTGGGGTTTCCAGTCTGGTT 0: 1
1: 0
2: 1
3: 24
4: 185
Right 1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 208
1151478808_1151478812 3 Left 1151478808 17:74358039-74358061 CCAGTCTGGTTGGGATCCATGGC 0: 1
1: 0
2: 0
3: 13
4: 90
Right 1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151478812 Original CRISPR CCTTCTCCTTGCCATGAGTC TGG Intronic
900470755 1:2853828-2853850 CCAGCTCCGTGCCATGAGCCTGG + Intergenic
902121832 1:14172887-14172909 CCTTCTCCATGCTGTGAGTGTGG + Intergenic
903796599 1:25933637-25933659 CCTTCTTCTTCCCATGAGAAAGG - Intergenic
904207507 1:28864501-28864523 CCTTCTCCTTCCCAAGCCTCTGG - Intergenic
906519783 1:46460184-46460206 CCTTCAACTCCCCATGAGTCTGG + Intergenic
912075780 1:105873554-105873576 CCTTCTCTTGGCCTTGGGTCTGG + Intergenic
912435734 1:109659849-109659871 CCTTCTCCTCTGCATGAGGCAGG + Intronic
912437674 1:109673254-109673276 CCTTCTCCTCTGCATGAGGCAGG + Intronic
912443473 1:109715980-109716002 CCTTCTCCTCTGCATGAGGCAGG + Intronic
913211907 1:116589281-116589303 TCTCCTCCTTGCCATGCGCCTGG + Intronic
918214847 1:182384527-182384549 TCTTCTCCTGGCCAACAGTCCGG + Exonic
920265023 1:204715338-204715360 CCTTCTGTTTGCCCTGAGGCGGG - Intergenic
921637312 1:217511915-217511937 GCTTCTCCTTGTCAAGAGTGGGG + Intronic
922475979 1:225907279-225907301 CCTTCTCCTTGCCGCCTGTCTGG - Intronic
1063946044 10:11177556-11177578 CCTTTGCATTTCCATGAGTCAGG + Intronic
1064280465 10:13946671-13946693 CCTTCTCCTTGCCAAGTGATTGG + Intronic
1064619523 10:17201359-17201381 CCTTCTCCTGGCGCCGAGTCTGG - Intronic
1070343001 10:75514684-75514706 CCTTTGTCTTGCCATGTGTCAGG + Intronic
1070681509 10:78452271-78452293 CCTTCTCCTTGGAATGCCTCTGG - Intergenic
1072736469 10:97882701-97882723 CCTGGACCTTGGCATGAGTCAGG + Intronic
1075997699 10:126891914-126891936 CCTCCTCTTTGTCATGATTCAGG + Intergenic
1076133269 10:128028304-128028326 CCTTCTGCCTGCCAGGAGTGAGG - Intronic
1077133268 11:985633-985655 CCTTCTCGTTGGCACGAGACTGG + Intronic
1078286279 11:9958857-9958879 TCTTCTCCTGGCCAACAGTCTGG + Intronic
1079307327 11:19334657-19334679 CCAGCTCTTTGCCATGAGTAGGG - Intergenic
1081393757 11:42560776-42560798 CATTCTCCTTCCCTTGAGTGTGG - Intergenic
1084612231 11:70210688-70210710 CCTTGTACTTGCCATGTGCCTGG - Intergenic
1085161741 11:74354038-74354060 CCTTCTCCTTGCCTTGTCTGTGG + Intronic
1088209867 11:107442992-107443014 CTTTTTCCTTGTCAGGAGTCTGG + Exonic
1089960493 11:122613566-122613588 TCTTCTCCTGGCCGAGAGTCTGG + Intergenic
1092857107 12:12684592-12684614 CCTTCTCCTTTCCAAGGCTCTGG + Intronic
1092925406 12:13267770-13267792 CCTTCTCCTGCACATCAGTCAGG - Intergenic
1093273406 12:17094389-17094411 CCTTCTCATTGCCCTGGGTTTGG + Intergenic
1093818011 12:23573655-23573677 AATTCTCCTTGCCTTGAGTTGGG + Intronic
1095815001 12:46411756-46411778 CCTTCTCCTTTTCATTCGTCAGG - Intergenic
1096464061 12:51838508-51838530 CCTTCCCCCTCCCATGACTCAGG + Intergenic
1096725334 12:53556788-53556810 CCATTCCCTTGCCATGAGTAAGG - Intronic
1096884800 12:54706483-54706505 GCTTCTCCTTGCCCTGCTTCAGG + Intergenic
1098222520 12:68285209-68285231 CCTCCTCCTTGCCCTATGTCTGG - Intronic
1099046221 12:77723596-77723618 CCTTCTCCCTGCCAGAAATCTGG + Intergenic
1102576126 12:113857271-113857293 CCTTCTCATTGCCACCAGCCTGG - Intronic
1105215158 13:18279907-18279929 TCTCCTCCTTGCCATGTGCCTGG + Intergenic
1105587807 13:21760888-21760910 CCTTCTTCATGCCACGAGCCTGG + Intergenic
1110598453 13:77343765-77343787 ACTTGTCCTTGCCTTAAGTCTGG - Intergenic
1112540540 13:100307535-100307557 CCTTCTCATGGCAATGAGTTAGG - Intronic
1113452045 13:110417555-110417577 CCTTCTCCATAGCATGATTCTGG - Intronic
1115500414 14:34044517-34044539 TGTTCTCCTTGCCATCATTCTGG - Intronic
1116369236 14:44108870-44108892 CCTTCTGCTGGCAATGAGTCTGG + Intergenic
1117105173 14:52390918-52390940 CCATCTCCTTGACCTGAGTAAGG - Intergenic
1122792696 14:104191015-104191037 CCTGCTCCCCGCCATGAGCCAGG + Intergenic
1202897398 14_GL000194v1_random:18157-18179 CCTTATGCTTACCAGGAGTCTGG - Intergenic
1124153229 15:27200997-27201019 CCTTCTCCATGCCCTGCCTCTGG + Intronic
1124706973 15:31974427-31974449 GCTTTTTCTTGCCAGGAGTCTGG + Intergenic
1125749894 15:42020966-42020988 TCTTCTGCTTGGCATGGGTCTGG + Intronic
1126774111 15:52085033-52085055 TCTTCTCCTTGCCTTGAATATGG - Intergenic
1127375702 15:58382565-58382587 CCTTCAGCTTCCCCTGAGTCTGG - Intronic
1128715198 15:69902989-69903011 CCATCTCCCTGCCAGGAGACAGG - Intergenic
1132035914 15:98484527-98484549 CCATCTCCTTGACATCAGGCTGG + Intronic
1137901177 16:52271206-52271228 CCTTCTCCTGGCCATGAGAGGGG + Intergenic
1138337050 16:56261467-56261489 TCTTCTCCTTGCCATGTGATTGG - Intronic
1141238223 16:82240525-82240547 CCTGCTTCCTGCCAAGAGTCTGG + Intergenic
1141939215 16:87263503-87263525 CCTGCTGCTTGCCCTGAGCCGGG + Intronic
1147562376 17:41517011-41517033 CCTTCTCCTGGCTCTGACTCAGG - Intronic
1149414906 17:56449008-56449030 CCTCTTCCTTGCCCTGCGTCAGG - Intronic
1150134701 17:62689446-62689468 CCTTCTCCTGGCCTTGTGCCTGG + Intronic
1150844715 17:68643647-68643669 CATTCTGCTTGCCATGAGCCAGG - Intergenic
1151017473 17:70573299-70573321 GCTTCCCCTTGACATGAGGCTGG - Intergenic
1151409327 17:73911003-73911025 CCTCCTCCTGCCTATGAGTCAGG - Intergenic
1151420253 17:73992471-73992493 CCTTCTCCTGGCCAGGGGTGTGG - Intergenic
1151478812 17:74358065-74358087 CCTTCTCCTTGCCATGAGTCTGG + Intronic
1152905080 17:82965547-82965569 CCTCCGCCTTGCCATGCCTCCGG - Intronic
1153385088 18:4484122-4484144 CGTTTTCCTTGTCATGAGGCAGG + Intergenic
1153715714 18:7846002-7846024 CAATCTCCTTGCCCTGACTCAGG - Intronic
1153978647 18:10291000-10291022 TCCTCTCCCAGCCATGAGTCAGG + Intergenic
1154957375 18:21272181-21272203 ACTTCTCCTTGCCGTCACTCAGG + Intronic
1157531970 18:48428894-48428916 CTTTCACCTTGCCGTGAGTAGGG + Intergenic
1157734848 18:50038245-50038267 CCTTCTCCTTCCCAAGTGACTGG - Intronic
1160060839 18:75527424-75527446 ACTTTGCCTTGACATGAGTCAGG + Intergenic
1160507059 18:79433048-79433070 CCTCCTCCTGGCCCTCAGTCAGG + Intronic
1163064845 19:14785257-14785279 ACTTCCCCTTCCCAGGAGTCGGG - Intergenic
1163311861 19:16519653-16519675 TCTTCTCCGAGCCTTGAGTCAGG + Exonic
1164689931 19:30203193-30203215 CATTCTCCTTGCCAGGAGCCGGG - Intergenic
1167349858 19:48967895-48967917 CCTTCTCCTTCCCCTGGGTCTGG + Intergenic
925341890 2:3143410-3143432 CTTGCTCCTTGCCAGAAGTCGGG + Intergenic
925794399 2:7526853-7526875 CCTTCTCCTTACCCTGTGACTGG - Intergenic
926307704 2:11650995-11651017 CCTTCTCCGTGCCATGGATAAGG + Intergenic
926395319 2:12435311-12435333 CGTTGTCTTTCCCATGAGTCTGG + Intergenic
926740420 2:16105894-16105916 CCTTCCCATTCCCCTGAGTCTGG + Intergenic
927922967 2:26987778-26987800 CCTTGTCCTAGAAATGAGTCTGG - Intronic
929809851 2:45180430-45180452 CATTCTCCTTCCCTTCAGTCTGG - Intergenic
929842484 2:45483695-45483717 CCTTCTCCTTGACATCAGACAGG + Intronic
930741850 2:54839734-54839756 CCCTCTCCTTGCCAGGAACCTGG + Intronic
931161622 2:59698523-59698545 CCTTCTCCAGGACATCAGTCTGG - Intergenic
932345093 2:70990209-70990231 CCTTCTCCTTGCTGCGAGTTTGG - Intronic
933606935 2:84393079-84393101 CCTTCTCCTCCTCAGGAGTCAGG - Intergenic
938104623 2:128521419-128521441 CCTTCTCTGTCCCATCAGTCAGG - Intergenic
938108613 2:128549858-128549880 CCTCCTGCCTGCCAGGAGTCTGG + Intergenic
938539207 2:132272712-132272734 CCACCTCCTTGACCTGAGTCAGG - Intergenic
939049660 2:137292983-137293005 CCCTCTCCTTGCCATGGGATAGG + Intronic
939091205 2:137781884-137781906 CATTCTTCTTTCCAGGAGTCTGG - Intergenic
942062920 2:172244346-172244368 CCTTTTCCTTGGCATGACCCAGG - Intergenic
942667574 2:178336597-178336619 CCTTCTCTCTGCCATGACTCAGG + Intronic
943222074 2:185122688-185122710 CCTACTCATTGCCATGTGACTGG + Intergenic
943928432 2:193819202-193819224 CCTTCTCATTGCCCAGAGTGTGG + Intergenic
945499118 2:210547020-210547042 CCTGGTCCCTGCCAGGAGTCAGG + Intronic
946884174 2:224206574-224206596 CCATCTCCTTGCCATGTCTGGGG + Intergenic
948013612 2:234670142-234670164 CCTCTTCTTTGCCATGAGTTGGG + Intergenic
948856649 2:240733361-240733383 CCCTCTCCCTGCAGTGAGTCTGG - Intronic
1168773170 20:428871-428893 CCTTCTCCCTGCCATGGGGAGGG + Intronic
1170176831 20:13480497-13480519 CTTGCTCCTTTCCACGAGTCTGG + Intronic
1171868149 20:30505563-30505585 CCACCTCCTTGACCTGAGTCAGG - Intergenic
1171907203 20:30908887-30908909 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1172032425 20:31991293-31991315 CCTTCCCCTTCCCATGGCTCTGG - Intronic
1174268261 20:49347742-49347764 CCTTCTCTTCTCCATGACTCAGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176551918 21:8227037-8227059 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176552312 21:8231500-8231522 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176570827 21:8410036-8410058 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176571217 21:8414092-8414114 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176578735 21:8454183-8454205 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176579131 21:8458654-8458676 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1176617083 21:9034146-9034168 CCTTATGCTTACCAGGAGTCTGG - Intergenic
1176665984 21:9688008-9688030 CCTTCTCCTTTCTCTGTGTCAGG - Intergenic
1176894289 21:14357853-14357875 CCTTCTCTTCCCCATGAGTCTGG - Intergenic
1178014400 21:28326997-28327019 TCATGTCCTTGCCATGAGCCAGG - Intergenic
1178053284 21:28770965-28770987 CCTTATTCTAGCCATGACTCTGG + Intergenic
1178580806 21:33836539-33836561 ACTTCTCCTTTCCACCAGTCAGG - Exonic
1179373201 21:40826122-40826144 GTTTCTCCTTGCCATGCTTCAGG - Intronic
1180340611 22:11614821-11614843 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1182331491 22:29554319-29554341 CCTTCTCCTTCCCAGGAGCAAGG + Intronic
1184808926 22:46815766-46815788 CCTTCACCTTGCCATAAAGCTGG - Intronic
1203256938 22_KI270733v1_random:143958-143980 CCACCTCCTTGACCTGAGTCAGG + Intergenic
949447808 3:4153987-4154009 CCTTCAACTTGCAAAGAGTCAGG + Intronic
949677598 3:6474613-6474635 TCTCCTCCTTCCCATCAGTCAGG + Intergenic
950120985 3:10482506-10482528 CCTTCTCCTCACCATCAGCCTGG - Intronic
950376512 3:12576807-12576829 CGTTCTCCTTCCCAGGAGTGTGG + Intronic
950593293 3:13955048-13955070 TCTTCTCCTTACCGCGAGTCTGG + Intronic
950647474 3:14385886-14385908 CCTTCTCCTTGCCTTGGTTAAGG - Intergenic
951109083 3:18780072-18780094 CTTTCTCCTTACTATGTGTCAGG - Intergenic
952982845 3:38752274-38752296 TCTTCTCCATGCCTGGAGTCAGG + Exonic
953957611 3:47243868-47243890 CCTCCTCCTTGCAACGAGTATGG + Intronic
960818616 3:121702003-121702025 CCTGCTCCTTTCCTTTAGTCTGG - Intronic
962873278 3:139516683-139516705 CCTACTCCTTGACAAGAGTTAGG - Intergenic
965663190 3:171064050-171064072 TCCTATCCTTGCCATGTGTCAGG + Intronic
966020230 3:175200703-175200725 CTTTCTCATTGCCATGAATTGGG + Intronic
966470486 3:180283401-180283423 CCTCCTCCTTGCCCTGATCCTGG - Intergenic
966924569 3:184635987-184636009 TCCTCTCCTTGACGTGAGTCAGG + Intronic
967946894 3:194811221-194811243 CCTTCTCCTTTCCAGAAGCCAGG + Intergenic
968854631 4:3110456-3110478 ACTTCTCTTTGCCATTAGCCTGG + Intronic
968937661 4:3620918-3620940 CCTTCTCCTGGGCAGGAGCCTGG + Intergenic
969381518 4:6802135-6802157 ACTTCTCCATTCCCTGAGTCTGG - Intronic
969936084 4:10683244-10683266 CGATCACTTTGCCATGAGTCAGG - Intronic
970924871 4:21439674-21439696 CCTTCTTCTTGCTTTGAGTATGG + Intronic
973932067 4:55803201-55803223 TCTCCTCCTTGCCAGGACTCAGG - Intergenic
973936279 4:55850082-55850104 CCCTCTCCTTGCAATTAGGCAGG - Intergenic
986126162 5:4884122-4884144 CCTTCTCCTGGCCAGGTTTCTGG - Intergenic
986461824 5:7980357-7980379 CCTTTTCCTTCTCATGTGTCTGG + Intergenic
986569539 5:9150768-9150790 CATTCTGCTTGCCATCAGACTGG - Intronic
986735466 5:10664561-10664583 ACTTCTCCTTTCCACCAGTCGGG + Intergenic
986820705 5:11463586-11463608 CTTACTCCTTGCCAAGAGTGCGG + Intronic
987796882 5:22639255-22639277 TCTGCTCCGTGCCATGATTCTGG - Intronic
988298327 5:29392816-29392838 CCTGCTCCTTTCCACTAGTCTGG + Intergenic
990393935 5:55356128-55356150 CCCACTCCTTGCCATGGGCCTGG - Intronic
992680902 5:79152140-79152162 CCTACTCCTTGCCAGCAGTTCGG + Intronic
993121662 5:83782280-83782302 TCTTCACATTGCCATGGGTCTGG - Intergenic
993126106 5:83837663-83837685 CCATCATTTTGCCATGAGTCAGG - Intergenic
993866299 5:93200570-93200592 AATTCTCCTTGCCAGGAGACTGG + Intergenic
998670462 5:144347639-144347661 CCTTCAGCTTCTCATGAGTCTGG - Intronic
999309567 5:150543246-150543268 CCTTCTCCTCCCCAAGACTCAGG - Intronic
1001124271 5:169005431-169005453 CGTTCACCTTGCCATGGGCCAGG - Intronic
1001220833 5:169899362-169899384 CTTTCTCCATGCCAAGAATCAGG + Intronic
1001224621 5:169933119-169933141 CCTTCTCCTTACCCTGTTTCAGG - Intronic
1001543608 5:172556391-172556413 CCTTCTCCCTGCCTTCATTCAGG - Intergenic
1002167122 5:177354937-177354959 TCTTCTCCATGCCATGAGAGTGG - Intergenic
1004015522 6:11728485-11728507 ACTTCTCTTTGCCCTGTGTCTGG + Intronic
1004344857 6:14839551-14839573 CTTTCTCCTTGCCCAGAGTAAGG - Intergenic
1005692523 6:28321084-28321106 CATTATCCTTTCCATGGGTCAGG - Intergenic
1006572128 6:35014461-35014483 CCTTCCCCTTGGCATGTGTCTGG + Intronic
1007249165 6:40483969-40483991 CCCTCTCCCTGCCAGGAGTGCGG + Intronic
1007618867 6:43199375-43199397 TCTTCTCCTTGCCAGGGTTCTGG - Intronic
1009691327 6:67036826-67036848 CCTTCTACTTTCTATGAGTTTGG + Intergenic
1010823380 6:80443192-80443214 CCTTCTCCTTGCCAGTAGGGAGG + Intergenic
1012374995 6:98551249-98551271 CTATCTCCTTGCCTTGAGGCAGG + Intergenic
1013693055 6:112667919-112667941 CCTACTCCTGTCCATGAGACTGG - Intergenic
1016027175 6:139299397-139299419 CCTTCTTCTTGCCATTAGTAAGG - Intergenic
1016538786 6:145139346-145139368 TCCTCTCCTTGCCATGGTTCTGG - Intergenic
1017443092 6:154482686-154482708 CCTTCTCCTTTCCCAGAGTTGGG - Intronic
1018900000 6:168046312-168046334 CCTTCTGCCCGCCATGAGTCAGG - Intergenic
1019784981 7:2970913-2970935 CTTTCTTCTTCCAATGAGTCTGG - Intronic
1020007741 7:4791366-4791388 CCTTCACCCTGGCATGAGGCCGG - Exonic
1020015502 7:4829176-4829198 CCACCTCCTTGCCGTGGGTCAGG + Intronic
1023608823 7:41954394-41954416 CCTTCCCCTCTCCAGGAGTCAGG - Intergenic
1024256578 7:47544234-47544256 CCTTCACCTATCCATGGGTCGGG + Intronic
1028238339 7:88387879-88387901 CCTCCTTCTTGCCATCAGTGTGG + Intergenic
1031106898 7:117554736-117554758 CCTTCTGCTTGACATCAGTTGGG - Intronic
1034416671 7:150968896-150968918 CATTCTCCTCGCCATGAAGCAGG - Intronic
1034831161 7:154308851-154308873 CCCTCTGCTTGCAATGAGCCAGG + Intronic
1036631647 8:10520053-10520075 CCTTCTCCATGAAATGAGGCAGG + Intergenic
1037776496 8:21839015-21839037 GTTTCTCCTTGCCATCTGTCTGG - Intergenic
1039119589 8:34130800-34130822 TTTTCACCTGGCCATGAGTCTGG + Intergenic
1039235217 8:35495606-35495628 CCTTCACCTTCCTATAAGTCAGG - Intronic
1043756103 8:84005760-84005782 CCTTCTCATTGCCTGCAGTCTGG + Intergenic
1043869260 8:85413039-85413061 CCTTCTCCTTGGTATGAGAGAGG + Intronic
1044800229 8:95945962-95945984 TCTTGTCCTTGCCATCAGTCTGG + Intergenic
1044994406 8:97825762-97825784 CCTTCATCTTACCATGAGCCAGG - Intronic
1047322548 8:123801670-123801692 CCTTCTCCTTGCCCCAAGGCTGG - Intronic
1047577267 8:126170904-126170926 CCTTTTCCTAGCCAAGAGGCAGG - Intergenic
1049402811 8:142437875-142437897 GCCTCTCCTTCCCATGAATCTGG - Intergenic
1050756606 9:9011996-9012018 CCTCCACCTTGCTATCAGTCTGG + Intronic
1051612569 9:18975493-18975515 CCTTCTCATTGCCTAGAGTAGGG - Intronic
1053232958 9:36427179-36427201 CTTAGTACTTGCCATGAGTCAGG - Intronic
1054453495 9:65416773-65416795 CCTTCTCCTGGGCAGGAGCCTGG - Intergenic
1055903480 9:81267305-81267327 CCTTCTCATTTCCCTTAGTCTGG - Intergenic
1060803884 9:126562993-126563015 CCTTTTCATTGCCATGAGCCTGG - Intergenic
1061883345 9:133578847-133578869 CCTTATCCCTGCCACGAGCCTGG + Exonic
1203473096 Un_GL000220v1:125641-125663 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1203473492 Un_GL000220v1:130112-130134 CCACCTCCTTGACCTGAGTCAGG + Intergenic
1203660114 Un_KI270753v1:33753-33775 CCTTCTCCTTTCTCTGTGTCAGG + Intergenic
1186589496 X:10915009-10915031 ACTTCTCTTTGCCATCAATCTGG + Intergenic
1193899126 X:87153814-87153836 CCTTCTCCTTGCGTTGAGGTTGG + Intergenic
1194145139 X:90253477-90253499 CCTTCTGCTTGCTTTGAGTTAGG - Intergenic
1201310733 Y:12596385-12596407 CCTGCTCCTCTCCATTAGTCCGG - Intergenic