ID: 1151479665

View in Genome Browser
Species Human (GRCh38)
Location 17:74362526-74362548
Sequence CACCTGGCTCAGCTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151479665_1151479674 28 Left 1151479665 17:74362526-74362548 CCAGGGGCAAGCTGAGCCAGGTG No data
Right 1151479674 17:74362577-74362599 CTGCCCCGTGCACCACTGCATGG No data
1151479665_1151479675 29 Left 1151479665 17:74362526-74362548 CCAGGGGCAAGCTGAGCCAGGTG No data
Right 1151479675 17:74362578-74362600 TGCCCCGTGCACCACTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151479665 Original CRISPR CACCTGGCTCAGCTTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr