ID: 1151479675

View in Genome Browser
Species Human (GRCh38)
Location 17:74362578-74362600
Sequence TGCCCCGTGCACCACTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151479671_1151479675 13 Left 1151479671 17:74362542-74362564 CCAGGTGGCAGGGCTGGGCATAG No data
Right 1151479675 17:74362578-74362600 TGCCCCGTGCACCACTGCATGGG No data
1151479665_1151479675 29 Left 1151479665 17:74362526-74362548 CCAGGGGCAAGCTGAGCCAGGTG No data
Right 1151479675 17:74362578-74362600 TGCCCCGTGCACCACTGCATGGG No data
1151479664_1151479675 30 Left 1151479664 17:74362525-74362547 CCCAGGGGCAAGCTGAGCCAGGT No data
Right 1151479675 17:74362578-74362600 TGCCCCGTGCACCACTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151479675 Original CRISPR TGCCCCGTGCACCACTGCAT GGG Intergenic
No off target data available for this crispr