ID: 1151480688

View in Genome Browser
Species Human (GRCh38)
Location 17:74368662-74368684
Sequence GACCAGAGCAGCCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151480688_1151480691 -4 Left 1151480688 17:74368662-74368684 CCTGCTTGTGGGCTGCTCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1151480691 17:74368681-74368703 GGTCACTCTTCCTCTAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1151480688_1151480689 -9 Left 1151480688 17:74368662-74368684 CCTGCTTGTGGGCTGCTCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1151480689 17:74368676-74368698 GCTCTGGTCACTCTTCCTCTAGG 0: 1
1: 0
2: 2
3: 30
4: 238
1151480688_1151480690 -8 Left 1151480688 17:74368662-74368684 CCTGCTTGTGGGCTGCTCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1151480690 17:74368677-74368699 CTCTGGTCACTCTTCCTCTAGGG 0: 1
1: 0
2: 1
3: 39
4: 399
1151480688_1151480693 9 Left 1151480688 17:74368662-74368684 CCTGCTTGTGGGCTGCTCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1151480693 17:74368694-74368716 CTAGGGCAGGAGAGCCAGTCTGG 0: 1
1: 0
2: 1
3: 20
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151480688 Original CRISPR GACCAGAGCAGCCCACAAGC AGG (reversed) Intronic
900157313 1:1208470-1208492 CAGCAGAGCAGCCCACGGGCCGG + Intergenic
900775612 1:4582773-4582795 GCCCAGAGAGACCCACAAGCTGG + Intergenic
900870356 1:5297798-5297820 GATCAGAGCAGTCCATATGCAGG + Intergenic
901506282 1:9687910-9687932 GCCCAGAGCACCCCCCAAGGAGG - Intronic
901970722 1:12905594-12905616 AAACAAAGCAGCCCAGAAGCTGG + Intronic
902014443 1:13296176-13296198 AAACAAAGCAGCCCAGAAGCTGG - Intergenic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
905206308 1:36344544-36344566 CAGCACAGCAGCTCACAAGCAGG + Intronic
906537094 1:46557044-46557066 GTGCCCAGCAGCCCACAAGCAGG - Intergenic
911045402 1:93623537-93623559 GCCTAGAGCAGCCCACAGCCAGG + Intronic
911548014 1:99244180-99244202 GCCCAGAGCAGGCAACAAGTGGG + Intergenic
912387824 1:109281107-109281129 GACCAGAGCAGCCAAGTTGCGGG - Intronic
916245806 1:162687092-162687114 GGCCAGAGCAGCCCAAAGCCTGG - Intronic
921163478 1:212489163-212489185 GACCAGAGTGGCCCACATGGAGG + Intergenic
922160623 1:223077185-223077207 GACCACAGCAGCCCACCATCAGG + Intergenic
924624390 1:245687402-245687424 GACCAGAGCAGAGCAGGAGCAGG + Exonic
1062777411 10:164500-164522 GACCAGAGCAGCCACCAATTGGG + Intronic
1063211282 10:3883349-3883371 CACCAGATGGGCCCACAAGCTGG - Intergenic
1063447426 10:6128158-6128180 GAACAAAGCAGCCCTCAGGCTGG + Intergenic
1064284978 10:13984194-13984216 AACCAGAGCAGCCCACATGGCGG + Intronic
1066034727 10:31469670-31469692 AAACAAAGCAGCCCAGAAGCTGG + Intronic
1067047558 10:42993022-42993044 GCCCAGAGGAGCCCATTAGCTGG - Intergenic
1067068329 10:43115902-43115924 GACCAGGACAGCCCAGGAGCAGG + Intronic
1067569566 10:47361434-47361456 GGCCAGAGTAGCCCCCAGGCCGG - Intergenic
1067667930 10:48294388-48294410 GACCAGTTCAGCCCACTAGAGGG + Intergenic
1068501058 10:57840308-57840330 GACCTGAGAAGCAGACAAGCCGG - Intergenic
1071812519 10:89199014-89199036 AACCAGAGCAGCCCACTAGGAGG + Intergenic
1072310453 10:94149238-94149260 AGCCAGAGCAGCCCAGAAGGTGG + Intronic
1074821537 10:117183059-117183081 GAGCAGAGCTGCCCCCAAACTGG - Intergenic
1078143360 11:8707314-8707336 GACCAGGCTAGCCCAGAAGCTGG + Intronic
1083459986 11:62804987-62805009 CATCAGGGCAGCCCACGAGCAGG + Intronic
1083995465 11:66269404-66269426 GACCAGAGAATCCCACAGGAAGG - Intronic
1084582049 11:70030107-70030129 GGCCAGGGCCTCCCACAAGCAGG - Intergenic
1089325204 11:117652241-117652263 GACTAGAGCAGGCAACACGCTGG - Intronic
1089401347 11:118166395-118166417 GCCCAGAGCAGCCATCAGGCTGG - Exonic
1091191197 11:133696683-133696705 GAACAGAAAAGCCCACAAGTAGG - Intergenic
1094828701 12:34290079-34290101 GACCAGCGCAGACCCCACGCAGG + Intergenic
1104853924 12:131893246-131893268 TCCCAGAGCAGCCCAGCAGCTGG - Intergenic
1106373339 13:29158886-29158908 CTCCAGAGAAGCCCACCAGCGGG + Intronic
1106546023 13:30731830-30731852 GTCCAGAGCAGCCCAGAATCCGG - Intronic
1112377149 13:98853970-98853992 GACCAAAGCACCCCAGAACCTGG + Intronic
1113474722 13:110572237-110572259 GGCCAGGGCAGCCCCCAAACCGG + Intergenic
1114530439 14:23392171-23392193 GAACAGAGCAGCTCACAGGAAGG + Intronic
1119409838 14:74423754-74423776 GACCAGAGGAGGGGACAAGCAGG - Intronic
1121606518 14:95244462-95244484 GACCAGAGGCACCCACAATCAGG - Intronic
1124372128 15:29109976-29109998 GACCAGGCCAGACCACCAGCTGG - Intronic
1125039206 15:35163699-35163721 GACCAGTGCAGTCCACAAAGGGG - Intergenic
1128732895 15:70033154-70033176 AAGCAGGGCAGCCCACTAGCTGG + Intergenic
1130287972 15:82571343-82571365 GCCCAGAGCAGCACACACTCGGG - Exonic
1131378005 15:91941160-91941182 GAGCAGTGCTGCCCACAACCAGG - Intronic
1132727981 16:1346990-1347012 GATCAGAGCAGCCCTGAGGCGGG - Intronic
1132813868 16:1816844-1816866 GCCCTGAGCAGCCCACAGGAAGG + Intronic
1132895299 16:2226282-2226304 CACCAGACAAGGCCACAAGCAGG - Intronic
1133177413 16:4025671-4025693 GACCAGGGCAGCCCACGGGAAGG + Intronic
1133442184 16:5830101-5830123 GAGCATTGCAGCCCACAAGATGG - Intergenic
1134070860 16:11258917-11258939 CAGCAGAACAGCCCACAAGGTGG - Intronic
1134842497 16:17413028-17413050 GACTAGTCCAGACCACAAGCTGG + Intronic
1135530092 16:23245662-23245684 GACCAGCCCAGGCCTCAAGCAGG + Intergenic
1142032900 16:87847260-87847282 CACCAGAACAGCCCAGCAGCTGG + Intronic
1146862420 17:36315239-36315261 AACCAGAGCAACCCACTGGCGGG - Intronic
1147092748 17:38119337-38119359 AACCAGAGCAACCCACTGGCGGG - Intergenic
1147104460 17:38201153-38201175 AACCAGAGCAACCCACTGGCGGG + Intergenic
1148425033 17:47587274-47587296 AACCAGAGCAACCCACTGGCGGG - Exonic
1149509948 17:57232188-57232210 CACCAGAGTAGCACAAAAGCAGG + Intergenic
1149789738 17:59466613-59466635 GACAAGACCAGACCACAAACTGG - Intergenic
1151480688 17:74368662-74368684 GACCAGAGCAGCCCACAAGCAGG - Intronic
1152255848 17:79239060-79239082 GTGCAGAGCAGCCCACAATTTGG + Intronic
1152462044 17:80446649-80446671 GACCAGAGCACCCCACTGGAAGG + Intergenic
1152800575 17:82328893-82328915 TCCCAGTGCAGCCCACACGCCGG + Intronic
1158436555 18:57438493-57438515 GTCGAGTGCACCCCACAAGCTGG - Intronic
1158691359 18:59664115-59664137 GAACTCAGCAGCCCACAACCTGG - Intronic
1161083034 19:2320995-2321017 GACCAGTCCATCTCACAAGCGGG + Intronic
1162862901 19:13521232-13521254 GACCCCAGCAGACCACAAGGGGG - Intronic
1163314615 19:16533254-16533276 GGCCAGAGCAGCCCAGAGTCCGG - Intronic
1163447883 19:17358147-17358169 GCCCTGAGCAGCCCACAGGGAGG - Intronic
1163658545 19:18562427-18562449 GACCAGAGGGGGCCACATGCAGG + Intronic
1165677901 19:37744210-37744232 GAGCAGAGCAGCTCCCAAGCAGG + Intronic
1167236383 19:48318506-48318528 GATCAGCGCAGCCCAGAACCAGG - Exonic
925416527 2:3673647-3673669 GACCAGGACAGCCCACCTGCAGG + Intronic
925600872 2:5607663-5607685 GTGCAGAGGAGCCCTCAAGCAGG - Intergenic
925628845 2:5868559-5868581 GCTCAGAGCAGCCCACACACAGG - Intergenic
926210006 2:10862626-10862648 GACCAGAGGAGGCAAGAAGCAGG + Intergenic
927266596 2:21159733-21159755 GTCCAGAGCAGCCAAAATGCTGG - Intergenic
927989229 2:27435693-27435715 GAACAGAGCAGCCCGTAAGCGGG - Intronic
932449835 2:71802369-71802391 GAAGAGAGCAGCCCAGAGGCTGG - Intergenic
933714891 2:85352668-85352690 CAACACACCAGCCCACAAGCCGG + Intronic
935180805 2:100689706-100689728 GCACAGAGCAGCCCAAATGCAGG + Intergenic
937988524 2:127649552-127649574 GGCCAGAGCAGCCCGCAGCCCGG - Intronic
942596821 2:177599432-177599454 GACTAAAGCAGCCCACAACAGGG - Intergenic
942596939 2:177600554-177600576 GACCACAGGAGCGCACCAGCAGG - Intergenic
945409943 2:209496266-209496288 ACCCAGAGCAGCCCACAGTCTGG + Intronic
945987935 2:216370229-216370251 CACCAGAGCAGCCCACACAGGGG + Exonic
1170907365 20:20528290-20528312 GACCTGTGCAGCCCACAGGCTGG - Intronic
1171154271 20:22858100-22858122 GAAAAGAGAAGCCCACAAACAGG - Intergenic
1172154004 20:32810932-32810954 GACTAGAACAGCCCACGTGCAGG + Intergenic
1174140141 20:48406969-48406991 GCCCAGAGCAGCCAACACTCTGG - Intergenic
1176243311 20:64084914-64084936 GACCAGAGAAGGCAGCAAGCAGG - Intronic
1176249741 20:64114845-64114867 AACCAGGGCAGCCCATCAGCAGG - Intergenic
1180037342 21:45256640-45256662 GACCAGAGCTGCCCCCGGGCTGG + Intergenic
1180068183 21:45423264-45423286 GACCAGACCGGCCAACACGCGGG - Intronic
1180126127 21:45791352-45791374 CACCAGACCAGACCACAGGCAGG - Intronic
1180902635 22:19385784-19385806 GGCCAGTGCTGCCCACCAGCAGG + Intronic
1181756633 22:25028953-25028975 GCCCAGAGCAGCGTCCAAGCTGG + Exonic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1182517030 22:30864786-30864808 GAGGAGAGCAGCCCTGAAGCAGG - Intronic
1182550538 22:31098683-31098705 GACCAGGCCAGCCCACGGGCCGG + Exonic
1182844053 22:33416263-33416285 GGCCAGAGCAGCACACACGGTGG - Intronic
1185183567 22:49378666-49378688 ATCCAGGGCTGCCCACAAGCTGG - Intergenic
1185342738 22:50299013-50299035 GCCAAGAGCAGCCCCCAAGCTGG - Intronic
950258396 3:11524698-11524720 GACCAGTTGAGCCCACAAGTTGG + Intronic
950307445 3:11927526-11927548 GACCAGGGGACCCCACATGCAGG + Intergenic
951631645 3:24728020-24728042 TACCTGTGCAGCCCACAAGAGGG - Intergenic
952490910 3:33871753-33871775 CAACAGAGAAGCCCACAGGCTGG - Intergenic
954143040 3:48620189-48620211 GCCCAGAGGAGCCAACAACCTGG - Intergenic
955416247 3:58694781-58694803 GAACAGAACACCCCAAAAGCAGG + Intergenic
963941701 3:151102225-151102247 CACCCAAGCAGCCCACAAGGAGG - Intronic
964472130 3:157067180-157067202 CTACAGAGCAGCCCACAGGCAGG - Intergenic
968456396 4:702781-702803 CAACAGAGCAGCCAACCAGCGGG - Intergenic
968820268 4:2844303-2844325 CACCCCTGCAGCCCACAAGCCGG - Intronic
969172058 4:5372016-5372038 GACCAATGCAGCCCACATCCTGG - Intronic
971322606 4:25617405-25617427 GACCAGAACATCACACTAGCAGG + Intergenic
972626943 4:40808588-40808610 GACCAGAAAACCCAACAAGCTGG + Exonic
979948813 4:126866516-126866538 AAACAAAGCAGCCCAGAAGCTGG - Intergenic
981235041 4:142405838-142405860 AACCACAACAGCACACAAGCAGG + Intronic
983286330 4:165743848-165743870 GACAAAGGCAGCCCTCAAGCTGG - Intergenic
984573616 4:181422360-181422382 GACCAGAGCAGCCCAGATCAAGG - Intergenic
985773442 5:1827221-1827243 GACAAGACCAGCCCGAAAGCAGG - Intergenic
997013828 5:129906565-129906587 GTCCAGAGCCGCCCACATTCCGG - Intronic
997362434 5:133303629-133303651 TTCCCGTGCAGCCCACAAGCTGG + Intronic
997579158 5:135006319-135006341 CTCCAGGCCAGCCCACAAGCTGG - Intronic
1000180160 5:158801355-158801377 GAGCAGAGAAGCCCTCAAACAGG - Intronic
1001256227 5:170185429-170185451 GACCCAAGCATCCCACAAGTGGG - Intergenic
1004604259 6:17179040-17179062 GTCCACAGCAGCCCCCATGCAGG - Intergenic
1005415970 6:25600636-25600658 AGCAAGAGCAGCCCACAGGCAGG + Exonic
1007369131 6:41414698-41414720 GACCAGAGAAGCCCAGCATCTGG - Intergenic
1008673511 6:53795876-53795898 GACCTGGGCAGCGCTCAAGCGGG + Intronic
1008932484 6:56954987-56955009 GACCTCAGCATCCCAGAAGCCGG + Intergenic
1012643324 6:101650073-101650095 GACCAAAGCAGCCTGAAAGCAGG + Intronic
1013231821 6:108167033-108167055 GACCCGCGCAGCCCACCAGTCGG + Intronic
1016326061 6:142902864-142902886 AACCACAGCAGCCCACAAGACGG + Intronic
1018687977 6:166318390-166318412 GGCCTCCGCAGCCCACAAGCTGG + Intergenic
1019524928 7:1476565-1476587 GACCAGCGCACCCCGCAGGCAGG - Exonic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1023995517 7:45157214-45157236 GTCCAGAGCTGCCCCCAGGCAGG - Intergenic
1024465266 7:49705691-49705713 GACCAGAACAGCCCACAGTCAGG + Intergenic
1024968251 7:55044579-55044601 GAACAGAGCAGCACACCTGCGGG + Intronic
1028985794 7:97007101-97007123 GCTCAGACCAGCCCACGAGCAGG - Intronic
1032650174 7:133869325-133869347 GCCCAGAGCTGCCCCCAGGCTGG - Intronic
1035057627 7:156046502-156046524 GGCCAGAGCAGCCCAGGTGCAGG - Intergenic
1038481494 8:27904923-27904945 GACCAGAGAAACCCTCAGGCAGG + Intronic
1041649145 8:60284319-60284341 GTCCAGAGCAGCGCACATGAAGG - Intergenic
1042040551 8:64584540-64584562 GACCAGGGCAGCCCCCAGGCAGG + Intergenic
1046317706 8:112528929-112528951 GACCAGCGCAGTACACCAGCTGG + Intronic
1048561551 8:135544173-135544195 GAGCAGTGAAACCCACAAGCAGG + Intronic
1049098245 8:140561280-140561302 GATCAGCGCAGCCCACAAGTAGG - Intronic
1049748411 8:144272646-144272668 CACCCTTGCAGCCCACAAGCAGG + Intronic
1056199519 9:84261332-84261354 GTCCAGAGCTGGCCACAAGGTGG - Intergenic
1060965925 9:127712294-127712316 GACCAGAGCCGCCTCCAGGCTGG - Exonic
1061100080 9:128485584-128485606 GCCCAGTGCAGCCCCCAACCCGG - Intronic
1061952943 9:133946298-133946320 GGCCAGAGCAGCCCAGCAACTGG + Intronic
1062033920 9:134374373-134374395 GACCAGAGCCACCCTCAGGCCGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062721963 9:138049397-138049419 GCCCAGGGAAGCCCACAAGAGGG - Intronic
1187195312 X:17077937-17077959 GCCCAGAGCAGCCCACCTGAAGG - Intronic
1189247886 X:39577518-39577540 GACCAGGGCAGCCCAGCAGCCGG + Intergenic
1191880253 X:65838303-65838325 GGCCATACCAGCCAACAAGCAGG - Intergenic
1195008470 X:100711117-100711139 GACCAGAGCAGTGCATAATCTGG - Intronic
1199529611 X:148831633-148831655 GAGCAGAGCATCCTACAGGCTGG + Intronic