ID: 1151480763

View in Genome Browser
Species Human (GRCh38)
Location 17:74369001-74369023
Sequence GTGGTAAGGCTGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151480763_1151480769 14 Left 1151480763 17:74369001-74369023 CCTGTCTGTGGCAGCCTTACCAC 0: 1
1: 0
2: 3
3: 8
4: 137
Right 1151480769 17:74369038-74369060 ACTTCCCCAACTCCTCACAGAGG 0: 1
1: 0
2: 4
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151480763 Original CRISPR GTGGTAAGGCTGCCACAGAC AGG (reversed) Intronic
900595454 1:3478305-3478327 GTGGGGAGGCAGCCACGGACGGG - Intronic
905289774 1:36913265-36913287 GTGGGCAGGCTGGCACAGAGGGG - Intronic
907110473 1:51922190-51922212 GTGATAAGGCAGTCAAAGACTGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
910504000 1:87928221-87928243 GGGGTAAGGATGACACAGAAAGG + Intergenic
917368262 1:174258248-174258270 TTGGTAAGGCTGCCACCTGCTGG - Intronic
924498597 1:244614316-244614338 CCGGAAAGACTGCCACAGACAGG + Intronic
1064065569 10:12178221-12178243 GTGGTAGGGCTGCCACACGCTGG - Intronic
1067760958 10:49046570-49046592 GTTGTAAAGCTGGCACAGAGTGG - Intronic
1067776909 10:49170697-49170719 GGGGAAAGGCTGCCACTGAGTGG - Intronic
1067816062 10:49477624-49477646 CTGGGGAGGCTGGCACAGACAGG - Intronic
1068274957 10:54782746-54782768 GTGGTAGTACTGCCACACACAGG + Intronic
1069565449 10:69460628-69460650 GTGGTCAGGCCACCACAGTCAGG - Intronic
1072846098 10:98832038-98832060 GTTGGAAGGCAGCCACAGTCTGG + Intronic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075567028 10:123512331-123512353 GTGGGGAGGCTGCCACAGACTGG - Intergenic
1075762143 10:124864952-124864974 GAGGTGAGGCTGCGACAGCCCGG - Intergenic
1077268129 11:1662062-1662084 GGGGTAAGGCAGCCACAGCCAGG - Intergenic
1077272754 11:1689556-1689578 GGGGTAAGACAGCCACAGCCAGG + Intergenic
1077336327 11:2006483-2006505 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1077410871 11:2403361-2403383 TTGGGAATCCTGCCACAGACAGG + Exonic
1078006985 11:7539612-7539634 GTGGTAAGGCCCTCACAGGCAGG - Intronic
1078798958 11:14623730-14623752 GTGGCCATGCTGCCAGAGACAGG + Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1080600803 11:33819278-33819300 GTGGGAAGGCACCCACAGAGAGG - Intergenic
1085970970 11:81590261-81590283 GTGGTCAGGCAGGCACAAACTGG - Intergenic
1087254036 11:95935268-95935290 GAGGAAAGGCAGCCACAGTCAGG + Intergenic
1089017391 11:115177663-115177685 GTGGTAAGCTTGACAGAGACAGG - Intronic
1090765374 11:129871682-129871704 GAGGCAAGGCTGCCGCAGATGGG - Intronic
1202819311 11_KI270721v1_random:61665-61687 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1096181711 12:49554763-49554785 AGGGTAAGGCTGCCTCAGACAGG - Intronic
1100113102 12:91269599-91269621 GTGCTAAGACTGCCTCAGCCTGG + Intergenic
1101916307 12:108898760-108898782 TTGGGAAGGCTGCTGCAGACTGG + Exonic
1103690645 12:122771639-122771661 GTGAGAAAGCTACCACAGACTGG - Intergenic
1104558686 12:129824752-129824774 GTGGAACAGGTGCCACAGACTGG - Intronic
1107028079 13:35823997-35824019 AAGGTAAGGCTGCTACACACAGG + Intronic
1110960239 13:81612378-81612400 GTAGTAAGGATGCCATAGACTGG + Intergenic
1114234639 14:20813392-20813414 GTGAGAATGCTGCCACAGAGTGG - Intergenic
1116515592 14:45800969-45800991 GAGGTGAGGCTGCCATAGAAAGG - Intergenic
1120103020 14:80466116-80466138 GAGGAAAGGCAGCCACAGTCAGG + Intergenic
1121243567 14:92447195-92447217 GTGGCAAGACAGCCACAGGCTGG + Intronic
1125134501 15:36326214-36326236 CTTGTAAGTATGCCACAGACAGG + Intergenic
1127581390 15:60342045-60342067 GTGTTTAGGCAGCCACAGTCAGG - Intergenic
1128589584 15:68883200-68883222 CTGCTAAGGCTGCCACTGTCAGG + Intronic
1129910385 15:79221540-79221562 GGGGTGAGGGTACCACAGACAGG - Intergenic
1132544926 16:528508-528530 CTGGCATGGCTGGCACAGACGGG - Intronic
1135983785 16:27168778-27168800 GTGGGAAGATTGGCACAGACCGG + Intergenic
1136661394 16:31766172-31766194 GAGGAAAGGCAGCCACAGTCAGG - Intronic
1138319734 16:56101831-56101853 GAGGAAAGACTGCCACAAACAGG - Intergenic
1139674144 16:68511364-68511386 GAGGAAAGGATGCCACAGCCTGG - Intergenic
1139981778 16:70864856-70864878 GTGGGAACGCAGCCACAGATAGG + Intronic
1146693630 17:34893049-34893071 GGGGTAAGGCTGCCCCCAACAGG + Intergenic
1147157365 17:38551033-38551055 GTGGTTGGGCTGCCACACAAGGG - Intronic
1148876319 17:50689580-50689602 GTGGGAAGGGTGCCATGGACAGG + Intronic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1153348703 18:4055730-4055752 GTACTAATGCTGCCACAGAATGG + Intronic
1161914846 19:7220744-7220766 TTGGTAAGTCTGCCACACATCGG + Intronic
1162424565 19:10586775-10586797 GAGGCAAGGCAGCCACAGATGGG + Intronic
1164814631 19:31185816-31185838 GTGGGAAGGCAGGCACTGACTGG - Intergenic
1167680370 19:50916519-50916541 GAGGGAATGCGGCCACAGACGGG + Intergenic
1167980477 19:53270905-53270927 GTGCGAAGGTTGCCACAGCCAGG + Intergenic
1167985698 19:53313311-53313333 GTGCGAAGGTTGCCACAGCCAGG - Intergenic
1168427776 19:56252844-56252866 GTGGTAAGGCAGCCACAGGCAGG + Intronic
925058420 2:872734-872756 GTTGTAATGCTGGCATAGACAGG - Intergenic
925307729 2:2861960-2861982 GGGGTAGGGCTGTCACAGAAGGG + Intergenic
927125799 2:20011965-20011987 GTCCTCAGGCTGCCTCAGACTGG - Intronic
927603825 2:24468163-24468185 GTGTTAAGGCAGCCACATCCAGG + Intergenic
931073193 2:58678221-58678243 ATGGTAGGGTTGCCACAGGCAGG + Intergenic
931421608 2:62133167-62133189 GATGAAAGGCTTCCACAGACAGG - Intronic
932062206 2:68514633-68514655 GAGGGAAGGCAGCCACAGAAGGG - Intronic
934680254 2:96278501-96278523 GTAAAAAGGCTCCCACAGACAGG + Intronic
937673856 2:124567438-124567460 ATGGGAAAGCTGCCACAGATTGG - Intronic
937949314 2:127371598-127371620 GAGGAAAGGCAGCCACAGTCAGG + Intronic
938071045 2:128308511-128308533 GGGGTCAGGCTGCCACCCACAGG + Intronic
940528971 2:154855199-154855221 GTGGCAAATCAGCCACAGACTGG - Exonic
941684398 2:168433582-168433604 GTGGTAGGGCAGACACAGAGAGG + Intergenic
941902365 2:170690737-170690759 TTGGTGAGGCCTCCACAGACAGG - Intergenic
947403508 2:229751699-229751721 GTGGTCTGGCTGACACATACCGG - Intergenic
948937763 2:241178791-241178813 ATGGTGAGGCTGCCAGACACAGG - Intronic
1172645486 20:36466574-36466596 GAGGAAAGGCAGCCACAGTCAGG - Intronic
1172846998 20:37935486-37935508 GTGGAAAGGCTGCCAGGGTCGGG - Intronic
1173724955 20:45290953-45290975 GTGGTGGGGCTGCCAGAGTCGGG + Intergenic
1173953008 20:47007955-47007977 GTGGTGAGGCTGGCTCAGAGGGG + Intronic
1175174205 20:57100870-57100892 ATGGTGAGGCTGACACAGAGTGG - Intergenic
1175214507 20:57384608-57384630 GTGGAAAGGCTGGCAAACACAGG - Intergenic
1176525023 21:7859531-7859553 GTGGCAGGGCTGCCAGAGAATGG - Intergenic
1178659043 21:34489544-34489566 GTGGCAGGGCTGCCAGAGAATGG - Intergenic
1180735588 22:18014155-18014177 CTGGTAGGACTTCCACAGACAGG - Intronic
1181525804 22:23485585-23485607 GTGGCCTGGCTGGCACAGACAGG + Intergenic
1183260126 22:36789411-36789433 GGGGTGATGCTGCCACAGCCAGG - Intergenic
1184848129 22:47101650-47101672 GTGCTAGGGCTGTAACAGACCGG + Intronic
953046086 3:39295049-39295071 GGGGTAAGGCAGCCAGACACAGG + Intergenic
955616251 3:60810111-60810133 GTGTTGAGGCTGACACAAACTGG - Intronic
959000113 3:100954486-100954508 GAGGAAAGGCTGCCAGAGAACGG - Intronic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
962686958 3:137857169-137857191 GTGGTAAGTCACCCACAGTCTGG - Intergenic
963368679 3:144369586-144369608 CTGGTAGGGGTGCCACAGGCAGG - Intergenic
969226802 4:5803920-5803942 GTGATGAGGCTGCCTGAGACAGG - Intronic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
970968869 4:21958457-21958479 GTTTTAAGACTGCCACAGTCTGG - Intergenic
974634303 4:64539431-64539453 GGGGTAAGGCTGCCACCTAGTGG + Intergenic
976825787 4:89258813-89258835 GTGGAAAGGCTGCTAGTGACAGG - Intronic
977227121 4:94405863-94405885 GTGGTTAAGCTGTCACTGACAGG - Intergenic
982862390 4:160469613-160469635 ATGGTGATGATGCCACAGACTGG + Intergenic
984197291 4:176673893-176673915 TTGGTAAGGCAGCCACAACCTGG - Intergenic
985164511 4:187078703-187078725 GTGTTAGGGCCTCCACAGACAGG + Intergenic
986583023 5:9284971-9284993 CTGGGAAGTCTGCCTCAGACTGG - Intronic
987033237 5:13994988-13995010 GTGGCAAGCTTGTCACAGACAGG + Intergenic
1004482430 6:16033524-16033546 TTGGTAAGGTTGCAACAGGCAGG - Intergenic
1006280716 6:33050947-33050969 GAGGAAAGGCAGCCACAGTCGGG + Intergenic
1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG + Intronic
1009324770 6:62337348-62337370 GTGGTGAGGCTCTCACAGAGAGG + Intergenic
1010625722 6:78134676-78134698 GAGGAAAGGCAGCCACAGTCGGG + Intergenic
1011621955 6:89251445-89251467 CTTGTCAGGATGCCACAGACGGG + Intergenic
1013263374 6:108469559-108469581 GTTGTAAGGGTGCAACAGGCAGG + Intronic
1016521729 6:144954015-144954037 TTGGTAAGTGTGCCACAGGCTGG + Intergenic
1019526096 7:1481171-1481193 TTGGTGAGGCTGGCACAGTCAGG - Intronic
1020017157 7:4837911-4837933 GAGGAAAGGCCGCCACAGATGGG - Intronic
1020112835 7:5457237-5457259 GTGGTGTGGGTGCCACAGAATGG + Intronic
1020963820 7:14840865-14840887 GTGGTAATACTGTAACAGACAGG - Intronic
1021622730 7:22564243-22564265 GTGGGGAGGGTGCCACAGGCAGG - Intronic
1023760737 7:43462906-43462928 GGTGAAAGGCTGTCACAGACAGG - Intronic
1024570242 7:50717182-50717204 GTTGTTAGGCTGCCACAAAGTGG - Intronic
1031601853 7:123719741-123719763 GTTGCAAGGGTGCAACAGACAGG - Intronic
1031948566 7:127867463-127867485 GTGGGAAGCCTGCTAGAGACAGG - Intronic
1032589983 7:133183037-133183059 CTGGCATGGCTGCCACAGGCTGG + Intergenic
1033263048 7:139860183-139860205 GTGGTAGGGCTACCAAAGCCTGG + Intronic
1033949545 7:146766826-146766848 GTGGGAAGGCTGCCTCATTCGGG + Intronic
1046418382 8:113945005-113945027 GTGTTTAGGCTGCCTCAGACAGG + Intergenic
1047358339 8:124144415-124144437 CTGGTACGGCTGCCAGAGATGGG + Intergenic
1047861915 8:128976263-128976285 GTGGCTAGGCTGACACAGCCAGG - Intergenic
1048746444 8:137619686-137619708 GTGGTAAGGCAGGCAGACACTGG - Intergenic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1055525847 9:77133061-77133083 ATGGTAATGCAGCCACAGATAGG - Intergenic
1057827012 9:98379056-98379078 GAGGTAAGAATGACACAGACGGG - Intronic
1058971396 9:110086653-110086675 GTGATATGGCTGCCAAAGACAGG - Intronic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1060800878 9:126545327-126545349 GTGGGGAGGGTGCCTCAGACTGG - Intergenic
1062558514 9:137128407-137128429 GTGAGAAGCCAGCCACAGACAGG - Intergenic
1062691268 9:137842767-137842789 GTGGCATGGATGACACAGACGGG - Intronic
1188082861 X:25865985-25866007 CTAGAAAGGATGCCACAGACTGG + Intergenic
1190152031 X:47957022-47957044 GTGCTATTGCTGCCACTGACAGG - Intronic
1190160629 X:48029127-48029149 GTGCTATTGCTGCCACTGACAGG + Intronic
1190358837 X:49630393-49630415 GTGATAAGACTGACACAGCCAGG - Intergenic
1190699852 X:52979553-52979575 GTCGTCAGGCTGCCAGGGACAGG - Intronic
1190729736 X:53217776-53217798 GTGGTAAGGATGTCACAGTGGGG - Exonic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1201780899 Y:17721678-17721700 GTGGAAAGGCTGTGACAAACAGG + Intergenic
1201820654 Y:18184312-18184334 GTGGAAAGGCTGTGACAAACAGG - Intergenic