ID: 1151492352

View in Genome Browser
Species Human (GRCh38)
Location 17:74440139-74440161
Sequence TGGCGAACAGAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151492352_1151492353 -5 Left 1151492352 17:74440139-74440161 CCTCTTTGGGGTTCTGTTCGCCA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1151492353 17:74440157-74440179 CGCCATCTGCTTCTCTTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 136
1151492352_1151492355 -2 Left 1151492352 17:74440139-74440161 CCTCTTTGGGGTTCTGTTCGCCA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1151492355 17:74440160-74440182 CATCTGCTTCTCTTGTCTGGCGG 0: 1
1: 0
2: 0
3: 27
4: 314
1151492352_1151492356 25 Left 1151492352 17:74440139-74440161 CCTCTTTGGGGTTCTGTTCGCCA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1151492356 17:74440187-74440209 CGTCTTTGCCCTCAACTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1151492352_1151492357 30 Left 1151492352 17:74440139-74440161 CCTCTTTGGGGTTCTGTTCGCCA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1151492357 17:74440192-74440214 TTGCCCTCAACTTCCTGGCCCGG 0: 1
1: 0
2: 0
3: 36
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151492352 Original CRISPR TGGCGAACAGAACCCCAAAG AGG (reversed) Exonic
900544463 1:3220730-3220752 TGGCAAACAGGAACCCAAACAGG + Intronic
902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG + Intergenic
902316437 1:15623295-15623317 TCCCGAACATAACCCTAAAGTGG - Intronic
904796732 1:33062012-33062034 TGGGGAACTGAGACCCAAAGAGG + Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
911500807 1:98682175-98682197 TGGAGAACAGAATACGAAAGGGG - Intronic
912442775 1:109712069-109712091 GGGCGCCCAGAAGCCCAAAGCGG - Intergenic
915896377 1:159814263-159814285 TGGTGCATAGAACCTCAAAGAGG + Exonic
918047037 1:180947875-180947897 TGGGGAAGAGAACCCCAGACAGG + Exonic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
921070686 1:211655386-211655408 TGGCCGACAGAACCGCAAGGTGG - Intergenic
923079139 1:230637192-230637214 TGGAAACCAGACCCCCAAAGAGG + Intergenic
1072959443 10:99915984-99916006 TGGCTACCAAAACCCAAAAGTGG - Intronic
1074505730 10:114068765-114068787 TGGAAGACAGATCCCCAAAGAGG + Intergenic
1074672779 10:115813092-115813114 TGGGCAAAAGAACCCCACAGAGG - Intronic
1074858737 10:117493061-117493083 TGGTGAACAGTCTCCCAAAGTGG + Intergenic
1076217058 10:128703604-128703626 GCGTGCACAGAACCCCAAAGAGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079464658 11:20717943-20717965 TGTGGACCAAAACCCCAAAGAGG + Intronic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1089343577 11:117776131-117776153 TGGCTGACACAACCCCAGAGAGG + Intronic
1089859844 11:121579444-121579466 TGGCGAAAAGAAAAGCAAAGAGG - Intronic
1091978310 12:4844564-4844586 TGAGGAACAGAACAGCAAAGGGG + Intronic
1092054107 12:5494600-5494622 TGGCGAACAGAACATCACGGCGG + Exonic
1092821459 12:12357234-12357256 TGGGGAACAGAAACGCAAGGAGG - Exonic
1093146778 12:15575810-15575832 TGGCCAACAGAAGCTGAAAGAGG - Intronic
1095396905 12:41771969-41771991 TGGCGATCAGAATCCCAAGAAGG - Intergenic
1096406845 12:51350204-51350226 TGGGAAACAGATCCCCAGAGAGG + Intergenic
1097583960 12:61492868-61492890 TGGAGAACAGGAGCCCAAAATGG - Intergenic
1101531813 12:105580484-105580506 TGCCTAATACAACCCCAAAGAGG + Intergenic
1101658283 12:106743490-106743512 TGGGGAACAAAACCCCTAAATGG - Intronic
1102343448 12:112142120-112142142 AGGCCAACAGCCCCCCAAAGAGG + Exonic
1103171823 12:118827373-118827395 TGCCAAACAGTCCCCCAAAGGGG + Intergenic
1108656181 13:52535349-52535371 AGGCAAACAGAAACCAAAAGTGG + Intergenic
1108768828 13:53670332-53670354 TGTTGTACAGTACCCCAAAGTGG - Intergenic
1109483831 13:62992793-62992815 TGGCTAACAGAATCCAACAGAGG - Intergenic
1109978290 13:69871248-69871270 TGGGGAGCAGTACTCCAAAGTGG + Intronic
1112763686 13:102718471-102718493 TGGAGAACAGATCCGAAAAGAGG - Intergenic
1113259563 13:108546726-108546748 TGCAACACAGAACCCCAAAGTGG + Intergenic
1113261381 13:108567535-108567557 TTACTAACAGAACCACAAAGAGG + Intergenic
1114391559 14:22314377-22314399 TGGTGAATAGCACCCCCAAGTGG - Intergenic
1115449702 14:33532397-33532419 TGCTGAAGAGAACCCCAAAGAGG - Intronic
1116931082 14:50691661-50691683 ATGCAAACAGAAACCCAAAGTGG - Intergenic
1127761093 15:62139846-62139868 TGGAGATCAGAAGTCCAAAGTGG + Intergenic
1128815434 15:70604832-70604854 TGGCAAACAGCACCACAATGAGG - Intergenic
1128876081 15:71202484-71202506 TGGCCTGCAGAAGCCCAAAGTGG + Intronic
1131063544 15:89418777-89418799 TGGGTTTCAGAACCCCAAAGAGG - Intergenic
1131113687 15:89780954-89780976 TGGCAAACAGAGCCGGAAAGGGG + Intergenic
1133081917 16:3328644-3328666 GTGAGCACAGAACCCCAAAGGGG - Intergenic
1139447422 16:67006494-67006516 TGGCGAAGGGGCCCCCAAAGAGG - Intronic
1146059407 17:29596586-29596608 TGGCAACCAGAACCCTGAAGTGG + Intronic
1147243878 17:39108294-39108316 TGGGGAAAAGGCCCCCAAAGCGG - Intronic
1148993200 17:51684300-51684322 TGGAGGTCAGAAGCCCAAAGTGG - Intronic
1149580783 17:57749001-57749023 TTGAGAACAGAACCCCAATTTGG - Intergenic
1151435448 17:74093037-74093059 TGGGGAACAGAAGCCCAACGTGG + Intergenic
1151492352 17:74440139-74440161 TGGCGAACAGAACCCCAAAGAGG - Exonic
1157371264 18:47114364-47114386 TGGGAAACTGAAGCCCAAAGAGG - Intronic
1157525439 18:48376887-48376909 TGGTGCACAGAAACGCAAAGAGG + Intronic
1158109563 18:53926159-53926181 TAGCTAAGTGAACCCCAAAGAGG + Intergenic
1158559543 18:58502526-58502548 CAGGGAACAGAACCCCAAGGTGG + Intronic
1160866862 19:1260058-1260080 GGGAGAACAGAGGCCCAAAGAGG + Intronic
1162722281 19:12669595-12669617 TGGGGAAAAGAACCTGAAAGCGG + Exonic
1163710680 19:18845013-18845035 TGGGGAGCAGCACCCCACAGAGG - Intronic
1165008627 19:32826673-32826695 TCTTGAACAGAACCCCAACGTGG + Intronic
931305676 2:61025941-61025963 TGGAGTTCAGAACCCTAAAGAGG - Intronic
936086711 2:109474332-109474354 TGGCTCACAGAAACCCACAGGGG - Intronic
938965552 2:136385302-136385324 AGGCTCACAGAACCACAAAGAGG - Intergenic
948685286 2:239666079-239666101 TGGTGAGCAGAGCTCCAAAGAGG - Intergenic
1172176526 20:32975843-32975865 TGGCAAACAGAGGCCCAGAGAGG - Intergenic
1173414896 20:42846673-42846695 CAGCGAAGAGAACCCTAAAGAGG - Intronic
1175821142 20:61909555-61909577 TGGCCAGCAGAACCCGGAAGAGG - Intronic
1176964647 21:15198326-15198348 TGGCTACCAGGGCCCCAAAGAGG - Intergenic
1183588440 22:38766544-38766566 TGGAGAACAGAGGCCCAGAGAGG - Intronic
949346431 3:3081089-3081111 TGGAAAACAGACCCTCAAAGTGG + Intronic
949532815 3:4974143-4974165 TGCCAAACAGATCTCCAAAGAGG - Intergenic
952734813 3:36678688-36678710 TGACTAACATAAACCCAAAGAGG + Intergenic
954776565 3:53024293-53024315 TGGGGGAAAAAACCCCAAAGAGG + Intronic
956639414 3:71401591-71401613 AGGCTAACAGAAACCCAGAGAGG - Intronic
960257096 3:115522232-115522254 TGGTGATCAGAATCCCAAATTGG + Intergenic
960938215 3:122916265-122916287 TGGTTAACAGGAACCCAAAGAGG + Intronic
961655488 3:128439321-128439343 TGGAGCACAGAACCCCACAGAGG - Intergenic
962457388 3:135577149-135577171 TGTTCAACAGAACCCAAAAGAGG + Intergenic
962855472 3:139340947-139340969 TGGTGAACAGAACCCCACCCAGG + Intronic
964406746 3:156356472-156356494 GGGACAATAGAACCCCAAAGAGG + Intronic
967884731 3:194325718-194325740 TGGGGAACTGAACTCCAAAGAGG + Intergenic
968747432 4:2367646-2367668 GGGCCAAGAGAACCCCACAGTGG + Intronic
969327702 4:6453329-6453351 TGGGAGACAGATCCCCAAAGAGG + Intronic
971253354 4:24991941-24991963 TAGAGAACAGGACCCCCAAGGGG + Intergenic
971843493 4:31887832-31887854 AGGCAAACACTACCCCAAAGGGG - Intergenic
979399112 4:120225978-120226000 TGAGGAAAAGAACCACAAAGAGG + Intergenic
983503528 4:168527510-168527532 AGATGTACAGAACCCCAAAGAGG - Intronic
984127312 4:175827749-175827771 TGGGAAACAGAACCTTAAAGAGG - Intronic
986746149 5:10747006-10747028 AAGGAAACAGAACCCCAAAGAGG - Intronic
993682702 5:90899393-90899415 TGGAGAACATAATCCCAGAGAGG - Intronic
997644057 5:135468576-135468598 TGGAGAACACAACCCAGAAGAGG - Intergenic
998252657 5:140563289-140563311 TGTGGACCAGAACCCCAAAGTGG + Intronic
998512120 5:142722309-142722331 TGGCCAACATAACACAAAAGAGG + Intergenic
999426420 5:151491104-151491126 TGGAGGACAGAACCACCAAGGGG - Exonic
1001618972 5:173065934-173065956 GGGCAAAGAGAAACCCAAAGGGG - Intronic
1003632271 6:7798368-7798390 TGGTGAACTGAAGCCAAAAGAGG + Intronic
1007696958 6:43740213-43740235 TGGGGAACTGAGGCCCAAAGAGG - Intergenic
1014480046 6:121925087-121925109 TGGCTCACAGAAGCCCAAGGAGG - Intergenic
1017293427 6:152767586-152767608 TAGAGAACAGAACAGCAAAGGGG - Intergenic
1026211262 7:68307572-68307594 AGGGGAACAGAACCGAAAAGTGG - Intergenic
1029796427 7:102899475-102899497 TGGAGAAGAGAACCACAAAGTGG + Intronic
1032984280 7:137319605-137319627 TGGAAAACAAAACCCCACAGGGG - Intronic
1034893441 7:154859941-154859963 TGGCTGACAGCACCCCACAGCGG + Intronic
1040915051 8:52560608-52560630 AGGCAAAGAGAACCCCACAGTGG + Intronic
1047204489 8:122792542-122792564 TGCCAAACAGTTCCCCAAAGTGG + Intronic
1048353547 8:133635118-133635140 AGGCCAACAGAATCCCAAAGGGG - Intergenic
1048881374 8:138875334-138875356 TGGCAAAGACAACCCCAGAGAGG - Intronic
1050105879 9:2166250-2166272 TGGCGCCCAGAACTCCAATGGGG + Intronic
1051356945 9:16248032-16248054 TGGCCAAGAGAACACCAGAGAGG - Intronic
1055779180 9:79800741-79800763 TGGCTAACAGCACCAGAAAGAGG + Intergenic
1057816136 9:98296439-98296461 TGGAGAACAAATCCCAAAAGTGG + Intronic
1059475920 9:114547563-114547585 TGGAGAACAAAACCCCAGACAGG - Intergenic
1062194898 9:135267542-135267564 TGGCTAAGAGAATTCCAAAGGGG - Intergenic
1062361217 9:136189200-136189222 TGGAAAACAGAACCCCGACGCGG - Intergenic
1186238816 X:7544411-7544433 TGAGGAACAGAAGCCCAGAGAGG + Intergenic
1186730753 X:12406882-12406904 TGGAGGTCAGAAGCCCAAAGTGG + Intronic
1188491754 X:30745320-30745342 TGGAGAACAGATCTTCAAAGTGG - Intergenic
1189230753 X:39450754-39450776 CCGCGCACTGAACCCCAAAGTGG - Intergenic
1189561232 X:42193227-42193249 TGGAGATCAGAAGCCCAAAATGG - Intergenic
1200836943 Y:7741088-7741110 GGGGGAACAGCACCCCAAACAGG - Intergenic
1201774179 Y:17646028-17646050 TAGCGACCAGAGCCCCACAGAGG - Intergenic
1201827378 Y:18259961-18259983 TAGCGACCAGAGCCCCACAGAGG + Intergenic