ID: 1151492819

View in Genome Browser
Species Human (GRCh38)
Location 17:74442909-74442931
Sequence CCCACACTGAATGCCGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151492804_1151492819 29 Left 1151492804 17:74442857-74442879 CCAGAGAGGTGGGGCTTACAGAC 0: 1
1: 0
2: 1
3: 103
4: 4582
Right 1151492819 17:74442909-74442931 CCCACACTGAATGCCGGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1151492809_1151492819 -9 Left 1151492809 17:74442895-74442917 CCTCAGGCCCCGCCCCCACACTG 0: 1
1: 0
2: 19
3: 84
4: 788
Right 1151492819 17:74442909-74442931 CCCACACTGAATGCCGGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151492819 Original CRISPR CCCACACTGAATGCCGGTCG GGG Intronic
900872218 1:5312216-5312238 CCCACACTGAATGGGGTTAGAGG - Intergenic
901037586 1:6345627-6345649 CCCTCACTGGATGCCGGGCATGG - Intronic
903339154 1:22643452-22643474 CGGACACTGACTGCCGGTGGGGG + Intergenic
1078323177 11:10355252-10355274 CCCACACTCCATGCCAGTTGAGG - Intronic
1083255830 11:61494930-61494952 GCCACACTGCAGGCCGGGCGCGG + Intergenic
1085249463 11:75132794-75132816 CCCATAATGAAGGCCGGGCGCGG + Intronic
1092959830 12:13585535-13585557 CGCACACTGCATGCCCCTCGGGG + Intronic
1093680204 12:21993676-21993698 CTCACACTGCATGTCTGTCGAGG + Intergenic
1103414343 12:120733931-120733953 CCCACACTGGATGCCTGACTCGG - Intronic
1104117858 12:125766802-125766824 CCCACACTGAATTCCAGTCTGGG + Intergenic
1104887671 12:132120281-132120303 CCCACACTGGGTGCTGGTGGGGG - Intronic
1111689829 13:91549754-91549776 CCCACACTAAATGCTGGTGAGGG + Intronic
1117499968 14:56341758-56341780 CTTACACTGAATGCCGGCCATGG - Intergenic
1121664181 14:95659274-95659296 CCCACTTTGAATGCAGGGCGAGG + Intergenic
1137668847 16:50267504-50267526 CCCACACTGGCTGCCCGTCCAGG - Intronic
1140525791 16:75621899-75621921 ACCAAACTGAAGGCCGGGCGCGG + Intronic
1140671809 16:77286983-77287005 CCCATACTGAGTGCCAGTCTAGG - Intronic
1143347619 17:6261514-6261536 GCCACACTGCATGGGGGTCGAGG + Intergenic
1147628731 17:41916664-41916686 ACCTCACTGAAGGCCGGGCGTGG - Intronic
1151492819 17:74442909-74442931 CCCACACTGAATGCCGGTCGGGG + Intronic
1152722473 17:81929727-81929749 GCCGCACTTAAAGCCGGTCGTGG - Intergenic
1154135685 18:11775676-11775698 CCCACACAGAATGCCTCTTGAGG - Intronic
1154941416 18:21116249-21116271 CCCACACTGAATCCGGGCTGGGG + Intergenic
1156475062 18:37400726-37400748 CCCAGAATGAATGCCGTTCATGG + Intronic
1162802295 19:13118284-13118306 CCCACAATGAATGGCCGCCGCGG + Intronic
1166751991 19:45168653-45168675 GCCACACAGTATGCCGGTCCTGG - Intronic
926736293 2:16075765-16075787 CCCACAAGGAATGCCGTTGGTGG - Intergenic
942983232 2:182106919-182106941 CCCCCACTGCATGCCCTTCGAGG + Intronic
1170694420 20:18645776-18645798 CCCAAACTGACTCCCGGTTGTGG - Intronic
1183665365 22:39243401-39243423 CCCACCCTGGCTCCCGGTCGGGG - Intronic
970113416 4:12664262-12664284 CCCACACAAAAGGCCGGGCGCGG - Intergenic
985123172 4:186664105-186664127 CCCACACTGCATCCCTGTGGCGG + Intronic
999231203 5:150063057-150063079 CCCCCACTGCATGCCAGTCTGGG - Intronic
1023905956 7:44521701-44521723 CCCACACTCACTGACGGTCGAGG + Exonic
1027576251 7:79934735-79934757 CCCAAACTGATTGCGGGTTGAGG - Intergenic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1056659872 9:88535725-88535747 CCCCCACTCACTGCCGGTAGGGG - Exonic
1060390773 9:123274851-123274873 ACCACACTGAAGGCCAGGCGTGG + Intergenic
1062625236 9:137439462-137439484 CCCACACTGAGTGGCAGGCGCGG + Intronic
1191252965 X:58268127-58268149 CACACACTGAATGAAGGTCAGGG + Intergenic
1195174348 X:102300607-102300629 CCCACAGTGGATGCCTGTTGAGG - Intergenic
1195184517 X:102386486-102386508 CCCACAGTGGATGCCTGTTGAGG + Intronic
1198464255 X:136890408-136890430 CCCACACACAAGGCCGGGCGCGG + Intergenic