ID: 1151493493

View in Genome Browser
Species Human (GRCh38)
Location 17:74446119-74446141
Sequence GCTGGGGGTATGGTAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151493480_1151493493 18 Left 1151493480 17:74446078-74446100 CCAGAGCCATGTCCTCCGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493491_1151493493 -9 Left 1151493491 17:74446105-74446127 CCAGCAACTGTGATGCTGGGGGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493484_1151493493 6 Left 1151493484 17:74446090-74446112 CCTCCGCCAGGGAAGCCAGCAAC 0: 1
1: 1
2: 0
3: 19
4: 213
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493483_1151493493 12 Left 1151493483 17:74446084-74446106 CCATGTCCTCCGCCAGGGAAGCC 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493485_1151493493 3 Left 1151493485 17:74446093-74446115 CCGCCAGGGAAGCCAGCAACTGT 0: 1
1: 0
2: 1
3: 23
4: 211
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493486_1151493493 0 Left 1151493486 17:74446096-74446118 CCAGGGAAGCCAGCAACTGTGAT 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210
1151493479_1151493493 19 Left 1151493479 17:74446077-74446099 CCCAGAGCCATGTCCTCCGCCAG 0: 1
1: 0
2: 0
3: 27
4: 201
Right 1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151493493 Original CRISPR GCTGGGGGTATGGTAGTGAC AGG Intronic
900313625 1:2046648-2046670 GCTTGGGGTAGGGTGCTGACCGG - Intergenic
902203526 1:14851369-14851391 GCTGGCAGTATGGGAGTGAGTGG - Intronic
903028528 1:20446370-20446392 GCTGGGGTGATGGAAGTGACTGG + Intergenic
903213397 1:21830718-21830740 GCTGGGGGTGGGGGAGTGCCTGG + Intronic
903246923 1:22022982-22023004 ACTGGGGTCATGGTGGTGACAGG + Intergenic
903852833 1:26318476-26318498 GCTGTGGTTATGGAGGTGACAGG + Intronic
907497981 1:54857851-54857873 GCTGGGGGAAGGGAAGTGACTGG + Intronic
909028958 1:70516425-70516447 GCTGGGGGTCTGGTGGGGGCAGG + Intergenic
910663030 1:89694076-89694098 TCTGTGGGGATGGTAGTGAATGG + Intronic
911140505 1:94496598-94496620 GGTAGGGGTAGGGTAGTGGCAGG - Intronic
913172286 1:116243752-116243774 GCTGGGGGCACAGCAGTGACAGG + Intergenic
913958321 1:143322060-143322082 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
914052636 1:144147435-144147457 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
914126561 1:144819106-144819128 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
914697149 1:150095093-150095115 GCTGGCGATATAGAAGTGACAGG + Intronic
915572241 1:156751065-156751087 GCTGGGGGCCGGGAAGTGACCGG + Intronic
916161217 1:161917060-161917082 GCTGGGGATATGGTGGTAAGTGG - Intronic
916624826 1:166544245-166544267 GCTGGGAGTAGGGTAGAAACAGG - Intergenic
921218717 1:212958295-212958317 GCTGGGGGCAGGGCAGTGGCGGG - Intronic
923495198 1:234518642-234518664 GCTGAGGATATGGCAGTGAATGG - Intergenic
923858181 1:237866939-237866961 GCTGGGGGGCTGGTAGTGGCAGG + Intergenic
924827129 1:247551410-247551432 GCTGGGGGTCTGATAATGAAGGG + Intronic
1065622559 10:27598844-27598866 GGTGGTGTTATGGTAGTAACAGG + Intergenic
1066576705 10:36833784-36833806 GCCGGGGTTAAGGTAGAGACGGG - Intergenic
1066759345 10:38738507-38738529 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1066962284 10:42234272-42234294 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1067743882 10:48918746-48918768 GCAGGGGGTAGGATGGTGACAGG + Intronic
1068983683 10:63087624-63087646 GCTGGAGGGATGGTATTGACAGG - Intergenic
1069782718 10:70966920-70966942 GCTGGAGGTCTGGGAGTGATGGG + Intergenic
1069878749 10:71578851-71578873 TGTGGGGGTATGGTAGGGAGAGG - Intronic
1071701218 10:87939215-87939237 GCTGGGGGTATGCATGGGACAGG - Intronic
1072251966 10:93588908-93588930 ACGGGGGCTATGGTAGTGATGGG + Exonic
1072801308 10:98394146-98394168 GCTGGGGATACGGTAGTGAGCGG - Intronic
1074542827 10:114379543-114379565 TCTGGAGGAATGGTAGAGACAGG + Intronic
1074876904 10:117620789-117620811 GCTTGGTGTGTGGTAGGGACAGG + Intergenic
1075336961 10:121615668-121615690 GCAGGGGGAATGGAAGAGACAGG + Intergenic
1075600066 10:123761235-123761257 GCTGTGGGTATGAGTGTGACGGG + Intronic
1077490130 11:2857270-2857292 GCTGGGGGCATGGTAGCATCAGG - Intergenic
1078848529 11:15143110-15143132 ACGGGGGGTATGGCAGTGAGTGG + Intronic
1082817898 11:57522519-57522541 GCTTGGGGGATGGTAGTAGCTGG - Intergenic
1084504086 11:69554280-69554302 GCTGGGGGCATGGTGGGGAAAGG - Intergenic
1084743882 11:71155493-71155515 GCTGGGGGCATGGGAGGGGCAGG - Intronic
1085038357 11:73312811-73312833 GCTGGGGGTCTGGCAGAAACGGG - Intronic
1085273136 11:75282089-75282111 GATGGGTGTATGGGAGTGTCTGG - Intronic
1085528726 11:77179258-77179280 TCTGGAGGAATGGTAGTGGCTGG - Intronic
1087597666 11:100273584-100273606 GCTGGGGGCAGGGCACTGACAGG - Intronic
1089644935 11:119872728-119872750 GCTGGGGGTGTAGTGATGACTGG - Intergenic
1091510752 12:1123007-1123029 GCTGGGGGAGTGGTTGTGGCAGG - Intronic
1093139142 12:15487562-15487584 GATGGGGGTATGGGGGTGACAGG - Intronic
1093396059 12:18683927-18683949 GGTGGGGGTGTGGGACTGACAGG - Intronic
1097116020 12:56697911-56697933 GGTGGGGGTTTGGTAGAGACAGG - Intergenic
1098691597 12:73496091-73496113 GCTGGGGGAATGGGAGAGATGGG + Intergenic
1101270081 12:103133541-103133563 GCTTGGGGTATGGTTGTTAATGG - Intergenic
1102203294 12:111073175-111073197 GGTGGGTGGTTGGTAGTGACTGG - Intronic
1102583356 12:113906452-113906474 GGTGGGGGGCAGGTAGTGACTGG + Intronic
1104933406 12:132352245-132352267 GCAGGGGGTGTGGGGGTGACCGG - Intergenic
1105589959 13:21783229-21783251 GCTGGGGGTAAGGGAGTGAGGGG + Intergenic
1110939352 13:81330358-81330380 GCTGGCGTGATGGTAGTGGCAGG - Intergenic
1114530509 14:23392665-23392687 GGTGGGGGTGGGGGAGTGACAGG + Intronic
1119516282 14:75251223-75251245 GCTGGGGCTCTGTTTGTGACTGG - Intronic
1121798931 14:96757308-96757330 GCTGTGGTTATGGTTGTGAGTGG + Intergenic
1122769786 14:104092847-104092869 GCTGAGGGGATGTTAGAGACAGG - Intronic
1122965642 14:105123962-105123984 GCTGGGGCAATGGGAGTGACCGG - Intergenic
1202930087 14_KI270725v1_random:28124-28146 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1123442786 15:20303233-20303255 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1124500262 15:30222069-30222091 ACTGGGGTTATGGAAATGACTGG - Intergenic
1124743313 15:32316597-32316619 ACTGGGGTTATGGAAATGACTGG + Intergenic
1128279426 15:66382640-66382662 GCTGGGATTACGGGAGTGACAGG + Intronic
1132793939 16:1709240-1709262 GCTGAGTGTATGAGAGTGACAGG + Intronic
1133284420 16:4683940-4683962 GCTGGGGGTCTGGGGGTGAGGGG + Intronic
1136582487 16:31161521-31161543 GCTGGGTGTTTGGTAGTGGCAGG + Intergenic
1136718468 16:32302481-32302503 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1136723438 16:32340656-32340678 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1136836843 16:33508751-33508773 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1136862535 16:33712241-33712263 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1137918282 16:52456507-52456529 GGTGGGGGTAGGGGAGTGCCTGG + Intronic
1138190386 16:55009445-55009467 GCTGGGGGTGTGGCAGTCACAGG + Intergenic
1138453326 16:57106431-57106453 GGCGGGGGTAGGGTAGTGATGGG + Intronic
1139004875 16:62558445-62558467 CCTGGGGCAGTGGTAGTGACAGG - Intergenic
1139919673 16:70451354-70451376 GCTGAGGACATGGTAGTGAGAGG - Intergenic
1140267458 16:73433083-73433105 GCTGGGGGGATGGAAGGGACAGG + Intergenic
1140866612 16:79067733-79067755 GCTGTGCCTATGGTAGTGCCTGG + Intronic
1203002994 16_KI270728v1_random:177109-177131 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1203007960 16_KI270728v1_random:215284-215306 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1203124017 16_KI270728v1_random:1560401-1560423 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1203134599 16_KI270728v1_random:1713515-1713537 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1203147019 16_KI270728v1_random:1809030-1809052 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142831674 17:2553800-2553822 GCTGAGGGTAGGGCAGTGGCAGG - Intergenic
1143966842 17:10761591-10761613 GCTGTGGGTAAGGGTGTGACAGG + Intergenic
1147243457 17:39105764-39105786 GCTGGGGGGATGGCAGTGGCAGG - Intronic
1148565055 17:48627677-48627699 GCAGGGGGTAAGGCAGTGAGGGG - Intronic
1149498944 17:57136651-57136673 GCTGGGGGTGAGGTGGTGTCGGG + Intergenic
1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG + Intronic
1151555967 17:74846941-74846963 GCTGGAGGAAGGGTTGTGACTGG - Intronic
1152017460 17:77761087-77761109 TCTGGGGGTGGGGTAGGGACTGG + Intergenic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152265583 17:79292446-79292468 GCCGGGGACATGCTAGTGACTGG - Intronic
1154415298 18:14172769-14172791 GCTGGGGCTAAGATAGTGACAGG + Intergenic
1155165472 18:23228690-23228712 GGTGGGGGAGTGGGAGTGACTGG - Intronic
1161102013 19:2425994-2426016 GCTGGGGCTATGGCTGTGGCCGG + Exonic
1161788088 19:6340672-6340694 GCAGGCAGTAAGGTAGTGACTGG + Intergenic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1162239236 19:9335456-9335478 TCTGGGGGTATGGGGGAGACAGG - Intronic
1166209435 19:41296687-41296709 GCTGGTGGAATGGAAGTGCCAGG - Intronic
1166755326 19:45187232-45187254 GCTGGGGCCATGGGAGGGACAGG + Intronic
1166801485 19:45460511-45460533 GCTGGGGACAAGGCAGTGACCGG + Intronic
1202692033 1_KI270712v1_random:99859-99881 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
925192026 2:1892636-1892658 GCAGGGTGTAGGGAAGTGACTGG + Intronic
926076948 2:9950367-9950389 GCTTGGAGCAGGGTAGTGACAGG - Intergenic
927810118 2:26175887-26175909 GCTGGGGGTGTGGTGGCGAAGGG - Intronic
927956062 2:27208128-27208150 GCTTAGTGTATTGTAGTGACTGG - Intronic
928189205 2:29146018-29146040 GGAGGGTGTCTGGTAGTGACTGG + Intronic
928431760 2:31225747-31225769 ACTGGTGGTATGGTGTTGACTGG + Intronic
929576008 2:43052373-43052395 GCTGGAGTAATGGGAGTGACTGG + Intergenic
929818330 2:45254039-45254061 GCTGGGGGTGTGATAGAGAGTGG + Intergenic
930670697 2:54147303-54147325 GCTTGAGGAATGGTGGTGACTGG + Intronic
932773514 2:74514399-74514421 GCTGGGGGTAGGGCAGGGGCGGG - Intronic
933512717 2:83261742-83261764 GCTGGGGGTGTGGTGGTGGCGGG + Intergenic
933954364 2:87354113-87354135 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
934112357 2:88755852-88755874 GCTGGGGGCTTGGTAGTCAAGGG - Intergenic
934238560 2:90250333-90250355 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
934274635 2:91566377-91566399 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
934322670 2:91982858-91982880 GCTGGGGCTAAGCCAGTGACAGG - Intergenic
934515215 2:94982015-94982037 GCTGGGGGCTTGGTAGTCAAGGG + Intergenic
935957042 2:108387589-108387611 GCTGGAGGCAAGGTGGTGACAGG + Exonic
937527965 2:122794323-122794345 GCTGAGGGTGTGGGAGTGGCAGG + Intergenic
939968419 2:148633806-148633828 GCTGGGGGAGGGGTGGTGACAGG - Intergenic
940240192 2:151554122-151554144 GTTGGGGGCAGGGCAGTGACTGG + Intronic
940272779 2:151909564-151909586 GCTGGGGGTTGGGGAGTGAGGGG - Intronic
941294256 2:163716198-163716220 ACTTGGGGTATGGTAATTACTGG + Intronic
946292308 2:218754551-218754573 GCCGGAGGGATGGTAGTGATGGG + Exonic
947697025 2:232199781-232199803 GCTGGGGGAATGATAGAGATGGG + Intronic
948379716 2:237543470-237543492 AGTGGGGGCACGGTAGTGACTGG + Intronic
948379767 2:237543660-237543682 AGTGGGGGCACGGTAGTGACTGG + Intronic
1170718163 20:18850042-18850064 GCTGGGGTGAAGGTATTGACTGG - Intergenic
1172883590 20:38217186-38217208 GCTGGGGCTATGGTGGGGACAGG - Intronic
1176592102 21:8656706-8656728 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1176858020 21:13986495-13986517 GCTGGGGCTAGGATAGTGACAGG - Intergenic
1176866565 21:14057683-14057705 GCTAGGGCTAGGATAGTGACAGG + Intergenic
1179826282 21:43968224-43968246 GCTGGGGGTGGGGTGGTGACTGG + Intronic
1180274953 22:10633835-10633857 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1180549426 22:16528762-16528784 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1181355267 22:22293074-22293096 GCTGGGGCTAGGCCAGTGACAGG + Intergenic
1182367734 22:29790048-29790070 GATAGAGGTATGGAAGTGACGGG - Intronic
949875370 3:8623148-8623170 GCTGGGGGTTGGGAAGTGCCAGG + Intronic
950169659 3:10829519-10829541 GTTGGGGGTATGGTGGGGCCAGG - Intronic
950268783 3:11596332-11596354 GCTGAGGGTATAATAGTCACAGG - Intronic
950474486 3:13206956-13206978 GCTGGGGATCAGGTTGTGACTGG - Intergenic
950654424 3:14427867-14427889 GCTGGGGAGATGGAAGTTACAGG - Intronic
950756178 3:15174674-15174696 GCTGGGTGTATGGGAGGGAAAGG - Intergenic
951137877 3:19125140-19125162 GAAGGGAGTAGGGTAGTGACTGG + Intergenic
951845272 3:27078369-27078391 GCTGGGTGAATGGCAGGGACAGG - Intergenic
952764960 3:36945491-36945513 GCTGGGGGTCCGGGAGTGAAGGG + Intergenic
954134375 3:48575355-48575377 GCTGGGGGTGTGGGAGAGGCAGG - Exonic
959896647 3:111614227-111614249 GGTGGGGGTAGGGAAGAGACAGG + Intronic
962960755 3:140309318-140309340 GCTTGGGGCATGTAAGTGACAGG + Intronic
966175064 3:177129581-177129603 GCTGGGGATAGAGTAATGACTGG + Intronic
966722900 3:183081957-183081979 GCTGCGGGCATGGGAGTGGCAGG + Intronic
966757029 3:183380769-183380791 GCTGGGGGTTTGGTACTTGCTGG + Intronic
967151041 3:186651360-186651382 GGAGGGGGTAAGGTAGTGGCAGG - Intronic
969835269 4:9835251-9835273 GCTTGGGTTGTGGTGGTGACTGG - Intronic
973393303 4:49573895-49573917 GCTGGCAGTAGGGTAGTGAGAGG + Intergenic
973821330 4:54664263-54664285 GCTGGGGGTAGGGAATTGGCTGG + Intronic
976642810 4:87356907-87356929 GGTTGGGGTAGGGTAGTGGCAGG - Intronic
976720574 4:88165159-88165181 GCTGAGGGTATGGGTGTGAATGG + Intronic
977179652 4:93857745-93857767 GCTGGGAGTATGCTAGCGAAGGG - Intergenic
978754196 4:112285599-112285621 GCTGGGGGTGAGGTGGGGACTGG - Intronic
981001906 4:139836418-139836440 GCAGGAGGTAGGGTGGTGACAGG + Intronic
985178030 4:187224145-187224167 CCTGGGGAGATGGTAGTGACTGG - Intergenic
990781758 5:59372630-59372652 GCTGGGGGTAGGGTGGTGGCAGG - Intronic
995076852 5:107994971-107994993 CCTCGGGGTAGGGTAATGACTGG + Intronic
997664551 5:135619793-135619815 GCTTGGGGTATGGTTGTTAGGGG + Intergenic
998093690 5:139384999-139385021 GCTGGGGGAATGGAGGTGCCTGG - Intergenic
998609640 5:143674076-143674098 GCTGGGGCTATGCTAGGCACTGG - Intergenic
998643776 5:144040753-144040775 GCAGGAGGTATGGTACAGACTGG + Intergenic
998650797 5:144119115-144119137 GCTGGTGGTATTGTAGAGGCAGG + Intergenic
998923148 5:147093208-147093230 TCTGGGGGTATGGTATTTTCTGG + Intergenic
1000168009 5:158673701-158673723 GCTGGTGATATGGAAGTGGCTGG - Intergenic
1001266567 5:170278445-170278467 GCTGGGGGGATGGGAGTGCAGGG + Intronic
1002774769 6:319247-319269 TCTGGGTGTCTGGTAATGACAGG + Intronic
1007208615 6:40172975-40172997 GGTGGGGGGATGGTGGTGAGAGG - Intergenic
1009724556 6:67521126-67521148 GCAAGGAGTAGGGTAGTGACTGG - Intergenic
1013436109 6:110109323-110109345 GATGGGGCTGTGCTAGTGACTGG - Intronic
1013995163 6:116299900-116299922 GCTGGTGTTTTGGCAGTGACTGG + Intronic
1015659010 6:135552758-135552780 GCTGTGGCCATGGCAGTGACAGG - Intergenic
1017996018 6:159532322-159532344 GCTAGGGGTTTGGTAGTGTGGGG - Intergenic
1019763568 7:2832316-2832338 GCTGTGTGTATGGTAGTGAGTGG - Intronic
1020243448 7:6412916-6412938 GCTGGGGGGTTGGGAGTGCCAGG - Intronic
1022102229 7:27175406-27175428 GCTGAGGGTATGGGAGGGAGGGG - Intronic
1027336477 7:77155990-77156012 GCTTGGGGTATGGTAGGAATGGG + Intronic
1027948347 7:84780222-84780244 GGTGGGGCTCTGGTAGGGACAGG + Intergenic
1029779313 7:102715111-102715133 GCTTGGGGTATGGTAGGAATGGG - Intergenic
1030104950 7:105979275-105979297 GCTGGGCACATGGTAGTGAGGGG - Intronic
1037646200 8:20794944-20794966 GCTGGGGGCATGGTGGTGGGTGG + Intergenic
1042690954 8:71498065-71498087 GCTGGGGGGATGTTAATGAAAGG + Intronic
1043386759 8:79756691-79756713 GGTGGGGGGGTGGTAGAGACAGG + Intergenic
1046898087 8:119494822-119494844 GCCAGGGGTCTGCTAGTGACTGG - Intergenic
1048861646 8:138728294-138728316 ACTGGGGTTATGGGGGTGACAGG + Intronic
1050236372 9:3585287-3585309 GCTGTGGAGATGGTAGTAACTGG - Intergenic
1053691475 9:40589362-40589384 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1054273328 9:63048123-63048145 GCTGGGGCTAGGTCAGTGACAGG + Intergenic
1054302733 9:63390328-63390350 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1054401507 9:64716833-64716855 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1054435115 9:65201153-65201175 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1054495275 9:65820528-65820550 GCTGGGGCTAGGTCAGTGACAGG + Intergenic
1059802457 9:117763982-117764004 GATGGGGGTAGGGGAGTGTCAGG - Intergenic
1059993350 9:119885897-119885919 GCTGGGGAAATGGTGGTGTCAGG - Intergenic
1061259651 9:129472807-129472829 GATGGGGGGATGGGGGTGACAGG + Intergenic
1062263962 9:135678328-135678350 GCTGGGGCTGGGGCAGTGACGGG + Intergenic
1062354171 9:136154080-136154102 ACTGGGGGAATGGGAGAGACTGG - Intergenic
1062354234 9:136154269-136154291 ACTGGGGGGATGGGAGAGACTGG - Intergenic
1062354258 9:136154338-136154360 ACTGGGGGGATGGGAGAGACTGG - Intergenic
1062354276 9:136154392-136154414 ACTGGGGGGATGGAAGAGACTGG - Intergenic
1062354287 9:136154427-136154449 ACTGGGGGGATGGGAGAGACTGG - Intergenic
1062354299 9:136154462-136154484 ACTGGGGGGATGGGAGAGACTGG - Intergenic
1203787889 EBV:137746-137768 GTGGGGGCTATGGTAGTGGCTGG + Intergenic
1203622153 Un_KI270749v1:135553-135575 GCTGGGGCTAGGTCAGTGACAGG - Intergenic
1186393020 X:9180241-9180263 GCTGTGATTATGGTAGGGACAGG + Intergenic
1188725579 X:33578227-33578249 GCTGGGGGAATGGTAGGGGTGGG + Intergenic
1189566590 X:42247854-42247876 GCTGGGGAACTGGTAATGACAGG - Intergenic
1190154247 X:47974948-47974970 GCTGGGGGGATGGAATTGAGAGG - Exonic
1190548836 X:51558160-51558182 GAAGGGGGAATGGTAGAGACAGG - Intergenic
1191164034 X:57368131-57368153 GGTTGGGGTATGGTAGACACTGG - Intronic
1192211922 X:69133157-69133179 TCTGGGGGTATGGCAGGGAGAGG + Intergenic
1196031243 X:111096997-111097019 GGTGGGGGGATGGTAATAACAGG + Intronic
1199221096 X:145316393-145316415 GCTGGGGCTATGCAAGTGAGTGG - Intergenic
1199740816 X:150734514-150734536 CCTTGGGATATGGTGGTGACAGG - Intronic
1200152595 X:153958600-153958622 GCTGGGAGGGTGGTAGTGCCAGG + Exonic
1201190166 Y:11438034-11438056 GCTGGGGCTAGGCCAGTGACAGG - Intergenic
1201270893 Y:12252742-12252764 GGTGGGGGGATGGAAGTGGCGGG - Intergenic
1201791332 Y:17843871-17843893 GCTGGGGGTGTGGAAGAGTCAGG - Intergenic
1201810222 Y:18062118-18062140 GCTGGGGGTGTGGAAGAGTCAGG + Intergenic