ID: 1151498860

View in Genome Browser
Species Human (GRCh38)
Location 17:74476012-74476034
Sequence AGGTGCCGCAGGGAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151498860_1151498868 16 Left 1151498860 17:74476012-74476034 CCTGCACCCTCCCTGCGGCACCT 0: 1
1: 0
2: 3
3: 38
4: 361
Right 1151498868 17:74476051-74476073 CAGGAAGCTCCTCCAAGCTTTGG 0: 1
1: 3
2: 6
3: 28
4: 239
1151498860_1151498866 -3 Left 1151498860 17:74476012-74476034 CCTGCACCCTCCCTGCGGCACCT 0: 1
1: 0
2: 3
3: 38
4: 361
Right 1151498866 17:74476032-74476054 CCTCAATATATTTATCAACCAGG 0: 1
1: 0
2: 4
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151498860 Original CRISPR AGGTGCCGCAGGGAGGGTGC AGG (reversed) Intronic
900339639 1:2181942-2181964 AGGAGCCGGAGGGAGGGGCCGGG - Intronic
900345507 1:2208540-2208562 AGATGCTGCAGGGAGGGGCCTGG - Intronic
900361580 1:2291628-2291650 AGGTGCTGGAAGGAGGGTGGGGG - Intronic
900513090 1:3069519-3069541 GGGTTCCGCGGGGAGGGGGCCGG - Intronic
900764928 1:4498367-4498389 AGGTGGTGCAGGGTGGGGGCTGG - Intergenic
900982732 1:6055716-6055738 AGGTGGGGCGGGGAGGGTGGTGG + Intronic
902361033 1:15942774-15942796 AGGGGCCGCAGGGATGGGGTGGG + Intronic
903338401 1:22639485-22639507 AGCTGCTGAAGGGAGGGGGCTGG + Exonic
903767361 1:25743410-25743432 AGCTGCCCCAGGGTGGCTGCAGG + Intronic
904501730 1:30916554-30916576 AGGTTCCACAGGGAGGGGGCAGG + Intergenic
904601100 1:31672977-31672999 AGCTGCCGCAGGGATGCGGCTGG - Intronic
905369281 1:37474633-37474655 AGGCGCGGCGGGGAGGGTGCGGG + Intronic
905860119 1:41344844-41344866 AGGAGCCCCAGAGAGGGTTCAGG - Intergenic
907458777 1:54592967-54592989 AGCTGGGGCAGGGAGAGTGCTGG + Intronic
907669439 1:56461932-56461954 AGGTGCTGCAGGGAGATTACAGG - Intergenic
912841741 1:113045034-113045056 AGGTACCCTAGGGAGGGTGTGGG + Intergenic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
913270411 1:117087649-117087671 AGGTGCCCCAGGGAGGGGCAGGG - Intronic
913340871 1:117757133-117757155 AGATGGCCCAGGGAGAGTGCTGG + Intergenic
915325875 1:155080899-155080921 GGCTGCCGCAGTGAGGGAGCCGG - Intronic
915354529 1:155248150-155248172 AGGTCCCCCAGGGAGTGGGCAGG + Exonic
915366519 1:155319927-155319949 AGGTGCCTGAGAGAGGGTGGTGG + Exonic
915459508 1:156061376-156061398 TGGCTCCGCATGGAGGGTGCAGG - Exonic
915841496 1:159216865-159216887 TGTTGCCGCAGGGAGGGTCGAGG + Intergenic
916055875 1:161068768-161068790 AGGTAACCCAGGGAGGGAGCTGG + Intronic
916126411 1:161575439-161575461 AGAAGCAGAAGGGAGGGTGCCGG - Intergenic
916136330 1:161657279-161657301 AGAAGCAGAAGGGAGGGTGCCGG - Intronic
916899733 1:169207790-169207812 CGGTGGGGAAGGGAGGGTGCTGG + Intronic
918963349 1:191307212-191307234 AGCTGCTTAAGGGAGGGTGCAGG - Intergenic
919817060 1:201448296-201448318 AGCTGCCGGATGTAGGGTGCGGG - Intergenic
920110872 1:203586257-203586279 ATGTGCAGCAGGGAGGGTGGGGG - Intergenic
920350960 1:205337660-205337682 GGGTGCCGAAGGGAGGGAGGTGG - Intronic
921269522 1:213454995-213455017 AGGTGCCTCAGGGAGCGTCCAGG + Intergenic
922696756 1:227734913-227734935 AGGGGCACCAGGGAGGGTGAGGG - Intronic
923042932 1:230332833-230332855 CGGTGCAGCAGGGTGAGTGCGGG - Exonic
923274564 1:232385179-232385201 AGGTGTGGCAGGCAGGATGCTGG - Intergenic
924571400 1:245240827-245240849 AGGTGGCTCAGGGAGGCTGGAGG + Intronic
1064203092 10:13300510-13300532 CGGTGCGGCAGGGAGGGTCCTGG - Intronic
1064423685 10:15211900-15211922 TGGTGCCACAGGGATGGAGCAGG + Exonic
1066360312 10:34723883-34723905 GGGTGCCGCAGGCTGGGAGCTGG + Intronic
1067054265 10:43042080-43042102 GGGTGCTCCAGGGAGGGTGCAGG - Intergenic
1067065513 10:43102001-43102023 GGGTGTGGCAGGGGGGGTGCTGG + Intronic
1067227661 10:44386153-44386175 CGGTGGCGAAGGGAGGGTGCAGG + Intronic
1067556804 10:47278419-47278441 AGGTGTCTCAGTGAGGCTGCGGG + Intergenic
1068525210 10:58120975-58120997 GGGTGCAGGATGGAGGGTGCAGG + Intergenic
1069932448 10:71891865-71891887 TGGTGCTGCTGGGAGGGTACAGG - Intergenic
1070288043 10:75097972-75097994 AGGTGCCACGGGGATGCTGCAGG + Intronic
1070916878 10:80160780-80160802 TGGAGCTGCAGGGAGGCTGCTGG - Intronic
1071341562 10:84653560-84653582 AGGGGCAGCAGTGATGGTGCTGG + Intergenic
1072699926 10:97633315-97633337 AGGCGCAGGAGGGAGGGGGCCGG - Intronic
1074818636 10:117163299-117163321 GGGGGCCGGAGTGAGGGTGCAGG + Intergenic
1074853226 10:117455311-117455333 TTGTGCCGGGGGGAGGGTGCGGG + Intergenic
1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG + Intronic
1075470313 10:122683842-122683864 AACTGCAGCATGGAGGGTGCTGG + Intergenic
1075684286 10:124353234-124353256 AGGGGCCGGCGGGAGGGAGCTGG - Intergenic
1075829302 10:125391923-125391945 AGGGGCGGCGGGGAGGGTGGAGG - Intergenic
1075919501 10:126198589-126198611 AGGAGCAGCAGGGGAGGTGCTGG - Intronic
1076319372 10:129566698-129566720 AGGTGCCATAGGGAGGGTCTGGG + Intronic
1076533609 10:131161583-131161605 AGTAGCTTCAGGGAGGGTGCTGG + Intronic
1076533621 10:131161644-131161666 AGTAGCTTCAGGGAGGGTGCTGG + Intronic
1076676410 10:132149666-132149688 AGGTGGGGCAGGGAGGGGGTGGG - Intronic
1076830825 10:132993325-132993347 AGCTGCCGCAGGGTGGGAGATGG - Intergenic
1077304940 11:1864792-1864814 AGGAGCCGAAGGGAGGGACCAGG + Intronic
1077304954 11:1864836-1864858 AGGTGCCAGAGGGAGGGACCAGG + Intronic
1077434392 11:2531794-2531816 AGGTGTGGCAGGGAGGCAGCTGG - Intronic
1077441595 11:2571556-2571578 GGGTGGAGCAGGGTGGGTGCAGG + Intronic
1077998624 11:7475270-7475292 GGGACCCACAGGGAGGGTGCTGG + Intergenic
1078455065 11:11468589-11468611 TGGGGCTGCAGGGAGGTTGCTGG + Intronic
1081387286 11:42486596-42486618 AGGTGCAGGAGGGAGGGTATAGG + Intergenic
1081492535 11:43579422-43579444 AGGGGCCGGAGGGAGCGGGCCGG + Intronic
1081995126 11:47359169-47359191 AGGTGCTGCACATAGGGTGCAGG + Intronic
1082870779 11:57942605-57942627 TGGGGCTGCAGGGAGGGAGCAGG - Intergenic
1083194980 11:61080573-61080595 AGGAGCCTCAGGTAGGGTGCTGG - Intergenic
1083616094 11:64027372-64027394 AGGGGCTGCAGGGATGGTGGTGG + Intronic
1083960448 11:66012283-66012305 AGGTGCGGCGGGCGGGGTGCTGG + Exonic
1084142099 11:67239525-67239547 AGGTGAAGCAGGCAGTGTGCCGG + Intronic
1084144150 11:67255198-67255220 AGGTGGGGCAGAGAGGGTGGTGG + Exonic
1084155885 11:67312269-67312291 AGGAGGTGCAGGGAGGGGGCGGG - Exonic
1084406441 11:68976715-68976737 AGGGGCCTCAGGGGGAGTGCAGG + Intergenic
1084678995 11:70654697-70654719 AGTTGGGGCAGGGAGGGGGCGGG - Intronic
1084952429 11:72674074-72674096 AGGTGCCACAGACAGGGTCCTGG - Intronic
1085654945 11:78305471-78305493 AGGTGGCACAGGGAGGCTCCAGG + Intronic
1088449722 11:109968432-109968454 ACCTTCCACAGGGAGGGTGCAGG + Intergenic
1089591612 11:119545870-119545892 GGCTGCTGCAGGGAGGGTGCTGG + Intergenic
1089629502 11:119775345-119775367 AGGAGCCCCAGGTAGGGTGGAGG + Intergenic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091145159 11:133273196-133273218 AGGTGCCTAAGAGAAGGTGCTGG - Intronic
1091321924 11:134657753-134657775 AGGAGCCTCAGGCAGGGTCCTGG + Intergenic
1091549776 12:1529122-1529144 AGGGGCAGCAGGGAGGGTCAGGG - Intergenic
1091586557 12:1820237-1820259 AGGTGCAGCCGGGGGGGTGAGGG + Intronic
1091695834 12:2627566-2627588 AGGTGCGCCAGGCAGGGCGCTGG - Intronic
1091794784 12:3291852-3291874 CTGTGCAGCAGGGAGGGTCCTGG + Intergenic
1092776369 12:11948124-11948146 AGGTCCCACATGGAGGGAGCAGG + Intergenic
1096258806 12:50078429-50078451 AGGTGCCCCAGGGTGGGGGCAGG - Exonic
1096501104 12:52064222-52064244 AGGGTCAGCAGGCAGGGTGCTGG + Intergenic
1096693782 12:53336190-53336212 AGGTCTGGCAGGGAGAGTGCAGG + Exonic
1097184032 12:57187115-57187137 AGGTGCAGCAGAGAGGGCTCGGG - Intronic
1102470281 12:113155865-113155887 AGCTTCCGCAGGGAGGGTGAGGG + Intronic
1102690122 12:114753807-114753829 AGGGGCTGCATGGAGGGTGGTGG + Intergenic
1103011315 12:117460583-117460605 AGTTGTGGAAGGGAGGGTGCAGG - Exonic
1103565114 12:121811580-121811602 AGGTTCCCCTGGGAGGGTGTTGG + Intronic
1105356362 13:19663478-19663500 TGGAGCAGCAGGGAGGCTGCTGG + Intronic
1107058300 13:36130339-36130361 AGGTGCAGCAGAGAGGGAGCCGG + Intronic
1108703963 13:52968276-52968298 GGGTGCAGCAGGGACGATGCTGG - Intergenic
1114491506 14:23105126-23105148 AGGTGCCAGAGGCAGAGTGCTGG + Intergenic
1115642930 14:35346898-35346920 GGGTGCAGCAGTGAGAGTGCGGG + Intergenic
1117307269 14:54488899-54488921 AGTTGCCGCTGGGAGGGCGGGGG - Intronic
1117342848 14:54806632-54806654 AAGGGGCGCAGGGAAGGTGCGGG - Intergenic
1119320896 14:73729683-73729705 AGGAGGGGCAGGGATGGTGCTGG + Exonic
1119665303 14:76481079-76481101 AGGTGCCCCAAGCATGGTGCTGG - Intronic
1120519255 14:85507626-85507648 AGGAACCCCTGGGAGGGTGCTGG + Intergenic
1121409203 14:93737712-93737734 ACCTGCCGCAGGGTGGGGGCAGG - Intronic
1122541413 14:102499695-102499717 AGCTGCCTCCGGGAGGGGGCGGG - Exonic
1122793283 14:104193407-104193429 AGGTGGCCCAGGGAGAGTGCAGG - Intergenic
1122994504 14:105255636-105255658 AGGCTCTGCAGGGACGGTGCTGG - Intronic
1123056844 14:105574836-105574858 AGGTGCCCCGGTGAGGGTGCAGG - Intergenic
1123081366 14:105696949-105696971 AGGTGCCCCGGTGAGGGTGCAGG + Intergenic
1124443524 15:29707680-29707702 AGGAGCTGCAGGGAGGCTCCAGG + Intronic
1125518640 15:40336475-40336497 AGGGGCCCCAGGGATGGAGCTGG + Intronic
1125539162 15:40459748-40459770 AGGAGCCCCAGGGAGGGTGCTGG - Exonic
1125752065 15:42036176-42036198 GGCCGCAGCAGGGAGGGTGCGGG + Intronic
1127256113 15:57295165-57295187 AGGTGGGGCAGTGAGGGAGCTGG + Intronic
1128285917 15:66436974-66436996 AGGAGCAGCAGGGAGGTAGCTGG - Intronic
1128683524 15:69667826-69667848 CGGTGCTGGTGGGAGGGTGCTGG + Intergenic
1129240063 15:74245716-74245738 CGCAGCCACAGGGAGGGTGCAGG - Intronic
1129269151 15:74410425-74410447 AGGTGGCGCACGGATGGTGAGGG - Exonic
1129298184 15:74611157-74611179 TGGTGCCCCTGGAAGGGTGCAGG - Intronic
1129318685 15:74761899-74761921 AGGGCCCACAGGGAGAGTGCAGG - Intergenic
1129655118 15:77518989-77519011 AAGTGCCCCAGGGATGCTGCAGG + Intergenic
1129742516 15:77996351-77996373 AGGTGCAGCAGGAATGGGGCTGG - Exonic
1129842961 15:78755105-78755127 AGGTGCAGCAGGAATGGGGCTGG + Intergenic
1131508538 15:93036347-93036369 AAGTGCCCCAGGGTGGGTGTTGG - Intronic
1131513198 15:93060939-93060961 AGGTGGCGCAGGGAAGCTGAGGG - Intronic
1132279738 15:100602599-100602621 AAGTGCTGAAGGGAGGGGGCGGG + Exonic
1132391405 15:101441311-101441333 AGGTGCTGCAGAGAGGAGGCAGG + Intronic
1132570457 16:641892-641914 GGGCGCCGCGGGGAGGGGGCGGG - Exonic
1132597411 16:759618-759640 AGGAGCCGCAGGTTGGCTGCGGG - Intronic
1132609912 16:810509-810531 CGGTGCAGCGGGGAGGGTGTGGG + Intronic
1132953498 16:2578334-2578356 AGGGGCTGCAGGGCCGGTGCGGG + Intronic
1132960854 16:2621833-2621855 AGGGGCTGCAGGGCCGGTGCGGG - Intergenic
1133102336 16:3486972-3486994 AGGTGCAGCCAGGCGGGTGCGGG - Intergenic
1133115586 16:3576367-3576389 ATGAGGGGCAGGGAGGGTGCAGG - Intronic
1133291157 16:4722075-4722097 AGGAGACGCAGGCAGGGTGGGGG + Intronic
1133326627 16:4945925-4945947 AGGTGGGGCAGGGAGGAAGCAGG - Intronic
1134090072 16:11386865-11386887 AGTGCCCGCAGGGAGGGAGCTGG + Intronic
1135468918 16:22712095-22712117 AGGTGCAGGAGGAAGGCTGCAGG + Intergenic
1136272194 16:29154928-29154950 AGGGGCCGCAGGGGGGCAGCTGG + Intergenic
1136344690 16:29667054-29667076 AGGAGACGGAGGGAGGGAGCGGG + Exonic
1137645090 16:50066538-50066560 AGGTGAGCCAGGAAGGGTGCGGG + Exonic
1138448909 16:57081349-57081371 AGGTGCAGCAGGAAGGCTGAAGG - Intronic
1138678133 16:58666549-58666571 AGAGGCCGCAGGGTGGGTGATGG - Exonic
1139471473 16:67180246-67180268 ATGTGAGGCAGGGAGGCTGCAGG + Exonic
1140223744 16:73063110-73063132 AGGTGCCGCGCGGAGGAGGCGGG + Intergenic
1140354772 16:74296551-74296573 GGGTGGCGGGGGGAGGGTGCTGG + Intergenic
1141121617 16:81362875-81362897 AGGTGCTGCGAGGAGGGGGCAGG - Intronic
1141137016 16:81473091-81473113 AGGGGCCGCAGGCAGGCTGGTGG - Intronic
1141592449 16:85077700-85077722 GGGGGCAGCAGGGAGGGTGCGGG + Intronic
1141647972 16:85377673-85377695 AGGTCCTGCAGGCAGGGGGCCGG + Intergenic
1141797800 16:86286636-86286658 AGGGGCCGCAGGGGCGCTGCGGG + Intergenic
1141881926 16:86865984-86866006 TGGTGCCCGAGGGAGGGTGGTGG + Intergenic
1142051290 16:87959838-87959860 TGGGGCCGCAGGGAGGTGGCCGG + Intronic
1142075771 16:88116832-88116854 AGGGGCCGCAGGGGGGCAGCTGG + Intronic
1142144741 16:88488158-88488180 AGGTGCCGCCGGCAAGCTGCAGG + Intronic
1142231588 16:88902630-88902652 AAATGCCGCAGACAGGGTGCTGG - Intronic
1142245855 16:88969745-88969767 AGGTGCCGGGGGGCAGGTGCTGG + Intronic
1142256415 16:89015789-89015811 AGGAGCCTCGGGCAGGGTGCGGG - Intergenic
1142298564 16:89242997-89243019 AGGTCCTGGAGGGAGGGTGGAGG - Intergenic
1142359199 16:89618916-89618938 GGGAGCTGCAGGGAGGGAGCAGG - Intronic
1142359336 16:89619221-89619243 GGGGGCTGCAGGGAGGGAGCAGG - Intronic
1142593606 17:1018971-1018993 AGTTTCAGCAGAGAGGGTGCTGG - Intronic
1143162864 17:4882730-4882752 AGTGACCGCAGTGAGGGTGCTGG - Intronic
1143573306 17:7775006-7775028 GGGTGGCGAAGGGAGGGTGTTGG + Intronic
1144061178 17:11583997-11584019 TGCTGCTGCAGGGAGGGTGTGGG - Intergenic
1144675892 17:17161346-17161368 ACGTGCTGCAGGTAGGGTGGAGG + Exonic
1144824401 17:18097780-18097802 AGGTGTCGCAGGGAGGGAGTGGG - Intronic
1145094166 17:20009855-20009877 AGGCACAACAGGGAGGGTGCGGG - Intronic
1147016330 17:37494625-37494647 AGGAGCAGGAGGGAGGGTGTGGG + Intronic
1148195447 17:45709664-45709686 AGGTGCGGCAGGTAGAGTGAGGG - Intergenic
1151440059 17:74122706-74122728 GGGGGCCGGATGGAGGGTGCAGG - Intergenic
1151498860 17:74476012-74476034 AGGTGCCGCAGGGAGGGTGCAGG - Intronic
1151605192 17:75131324-75131346 AGGACCCGCAGGGAGGCTCCTGG + Intronic
1151849618 17:76682710-76682732 AGGAGCCACAGGGAGCATGCGGG + Intronic
1152072578 17:78141129-78141151 AGGGGCCCCAGGGAGGCTTCGGG - Exonic
1152797468 17:82315262-82315284 TGGTGGGGCAGGGAAGGTGCTGG + Exonic
1152888191 17:82864880-82864902 CGGTGCCCCAGGGAGTGAGCAGG - Intronic
1153050708 18:901016-901038 CTGTGCCTCAGGGAGGATGCTGG + Intergenic
1154027874 18:10724960-10724982 ATGTGAGGCAGGGAGGCTGCAGG - Intronic
1155638680 18:27986019-27986041 AGGAGGGGCAGGGAGGGTACGGG - Intronic
1156284147 18:35674511-35674533 AGGTGCTGCAGGGACAATGCAGG - Intronic
1156755376 18:40517568-40517590 AGGTATGGCAGGGAGGGTGGAGG - Intergenic
1159038414 18:63299419-63299441 AGGTGCCCAAGTGAAGGTGCTGG - Intronic
1160129564 18:76212794-76212816 AGGAGCCGGAGAGAGGGAGCTGG - Intergenic
1160708034 19:538959-538981 TGGTGCCTCAGGGAGGTGGCCGG - Intronic
1161026587 19:2039957-2039979 AGGAGCCCCAGGGTGGGGGCTGG - Intronic
1162343525 19:10106437-10106459 AGGTGGCGCAGGTGGGGTCCCGG + Intronic
1162355926 19:10184793-10184815 AGGTGCCCCAGGCAGGGACCAGG + Intronic
1162683742 19:12365272-12365294 AGCTGCCCCAGAGAGGGCGCGGG + Intronic
1162723603 19:12676604-12676626 AGGTGCCACAGGGAGCCTGCTGG - Intronic
1163484189 19:17576672-17576694 AGGTGGGGCTGGGGGGGTGCAGG + Intronic
1163828441 19:19536390-19536412 AGGTGACGGAGGCTGGGTGCAGG + Intronic
1164669471 19:30064425-30064447 AGGTGCCACGGGGTGGGGGCTGG - Intergenic
1164996085 19:32720816-32720838 TGGGGGCGCAGGGAGGGTTCAGG - Intronic
1165046339 19:33108044-33108066 AGGAGGGTCAGGGAGGGTGCGGG - Intronic
1165992738 19:39825691-39825713 AGGGGCCCCAGGGAGGGGGCAGG + Exonic
1166175696 19:41067894-41067916 AGGTGCCCAAGGGAGAGTGGGGG + Intergenic
1166856758 19:45786098-45786120 AGGTGTGCCAGGGAGGGTGCGGG + Exonic
1166992156 19:46699090-46699112 AGCTGCAGCAGGGAGGGCGAGGG - Intronic
1167402995 19:49285381-49285403 GGCTGCCGCATGGAGGTTGCTGG + Intergenic
1167517120 19:49929897-49929919 ACGTGGGGCAGGGAGGGTGGAGG - Intronic
1167711717 19:51115757-51115779 TGGTGCAGCAGGGTGGGTGGGGG + Intergenic
1168339411 19:55614830-55614852 AGATGCCGCAGGGCAGGCGCAGG - Exonic
925319134 2:2948664-2948686 GGGTACCCCAGGGAGGGTGGAGG + Intergenic
925922413 2:8646659-8646681 AGCTGCTGCAGGGAGGGTGCAGG + Intergenic
926098352 2:10097425-10097447 AGGGGCCGCCGGGTGGGGGCTGG - Intergenic
928093422 2:28390448-28390470 AGGCGCCGCCGGGAGCGCGCGGG - Intergenic
928455316 2:31415681-31415703 AGGGGCAGTTGGGAGGGTGCTGG - Intergenic
934053240 2:88227786-88227808 AGGAGCCACAGGGAAGCTGCTGG + Intergenic
934163337 2:89272620-89272642 AGGGCACGCAGGGAGGGTGGGGG + Intergenic
934715216 2:96539061-96539083 AGGTGCCTTGGGGAGGGAGCAGG + Intronic
937109305 2:119350593-119350615 AGCTGCAGAGGGGAGGGTGCTGG - Intronic
937370969 2:121296829-121296851 AGCTGCAGCAGGGGTGGTGCAGG - Intergenic
937672574 2:124553955-124553977 AGGTGCCGATGGGAGTGTTCTGG + Intronic
937988672 2:127650216-127650238 AGGTGGGTCAGGGAGGGTCCAGG + Intronic
937993191 2:127675257-127675279 AGGTGACGGTGGGAGGTTGCGGG + Intronic
938763678 2:134446278-134446300 AGGTGACCCAGGGAGCGAGCAGG + Intronic
939594877 2:144110851-144110873 AGGTGCCAGAGGGAGACTGCAGG - Intronic
941164888 2:162074153-162074175 AGGCGCCGCGGGCAGGCTGCAGG + Exonic
941295818 2:163736741-163736763 GGGGGCCCCGGGGAGGGTGCCGG - Intergenic
942167400 2:173255194-173255216 AGTTGCTGCAGGGAGGATGATGG + Intronic
942231137 2:173861786-173861808 AGGTGCTGCAGGCAGGGGGAGGG - Intergenic
943348526 2:186770182-186770204 AGGCGATGCGGGGAGGGTGCGGG + Intergenic
944557680 2:200904312-200904334 GGCTGCCGCAGGCAGGGGGCAGG + Intergenic
945648812 2:212536296-212536318 AGGTGCGGCAGGGTGGGGGTGGG + Intronic
946025234 2:216667948-216667970 AGGTGTCTCAGAGAGGGTGAAGG + Intergenic
946395417 2:219441811-219441833 AGGGGCCCCAGGTGGGGTGCAGG + Intronic
947593751 2:231398655-231398677 GGGTGTCGCAGGCATGGTGCAGG - Exonic
948291993 2:236832417-236832439 ATGTGCAGGAAGGAGGGTGCTGG + Intergenic
948729106 2:239952233-239952255 GGGGGGCGCAGGGAGGGGGCTGG + Intronic
948754358 2:240150458-240150480 AAGTGCCCCAGGGAGCTTGCAGG - Intergenic
948767405 2:240230346-240230368 AGGTGCCTCAGCGATGGTCCAGG + Intergenic
949041259 2:241850969-241850991 AGGAGAAGCAGGCAGGGTGCAGG - Exonic
1168757456 20:326749-326771 ACGTGCCCGAGGGAGGCTGCAGG - Exonic
1169075106 20:2755580-2755602 AGGCGCAGCAGGGAAGGTGGTGG - Intronic
1171278005 20:23875022-23875044 AGGTGCAGCACGGTGGGTGCTGG + Intergenic
1171458293 20:25283992-25284014 GAGTGCCGCAGGGAGGGGGCAGG - Intronic
1172162134 20:32876070-32876092 AGGTGCTGGAGGGAGGCTGGAGG + Intronic
1173741625 20:45406234-45406256 GGGTGCCGGAGGCAGGGTTCGGG + Intronic
1173849177 20:46207172-46207194 AGGAGCCCCAGGGAAGGGGCCGG + Intronic
1175725213 20:61313303-61313325 AGAAGCAGCAGGGAGGGTTCTGG + Intronic
1175783065 20:61695957-61695979 AGGAGCCTCATGGAGGGGGCTGG - Intronic
1175826602 20:61939552-61939574 AGGTGGAGCTGGGAAGGTGCAGG - Exonic
1175830993 20:61965598-61965620 GGGTGCCGGGTGGAGGGTGCCGG - Intronic
1176065319 20:63191269-63191291 ACTTGCGGGAGGGAGGGTGCTGG + Intergenic
1176083182 20:63284173-63284195 AGGTGCTGGAGGGAGGGCGGGGG + Intronic
1176254083 20:64141495-64141517 AGGTGCTGCAGGGAGGGCCCCGG + Intergenic
1176412043 21:6454389-6454411 AGGTGGCACAGGCAGGGAGCAGG - Intergenic
1177010927 21:15729903-15729925 AGGAGCCGCCGGGCGGGGGCGGG + Intergenic
1179541406 21:42085436-42085458 AGCTGCCACAAGGAGGGTGCAGG - Intronic
1179542752 21:42094311-42094333 TGGTTCAGCAGGGAAGGTGCCGG - Intronic
1179687537 21:43062711-43062733 AGGTGGCACAGGCAGGGAGCAGG - Intronic
1179934858 21:44596321-44596343 AGGAGCCACAGAGAGGGTGATGG - Intronic
1180092093 21:45538464-45538486 AGGTGGCCCAGGGAGGGCACAGG + Intronic
1180096654 21:45558445-45558467 TGGTGCCGCAGAAGGGGTGCTGG + Intergenic
1180657420 22:17434639-17434661 GGGAGCAGCAGGGGGGGTGCGGG - Intronic
1181646740 22:24235427-24235449 AGGTCCCACGGGGTGGGTGCAGG - Intronic
1181802027 22:25354017-25354039 AGGTGCAGCAGGGATGGGCCTGG - Intronic
1183102446 22:35592350-35592372 AGGGCCCGCAGGGAGGGCTCAGG + Intergenic
1183369343 22:37423730-37423752 GGGTGCCAGAGGAAGGGTGCTGG - Intronic
1183405256 22:37627401-37627423 AGCAGCTTCAGGGAGGGTGCTGG - Intronic
1183733482 22:39630962-39630984 AGGTGTGGCAGGGAGGATGGAGG + Intronic
1184074498 22:42167563-42167585 CAGTGACGCAGGGAGGGTGAAGG + Intronic
1184108413 22:42381768-42381790 AGGTGAGGGAAGGAGGGTGCTGG - Exonic
1184173175 22:42771478-42771500 AGGTGTCTCAGGGAGGATGCTGG - Intergenic
1184375179 22:44107544-44107566 AGGTGACTCAGGGTGGGGGCTGG + Intronic
1184403657 22:44287840-44287862 GGCTGCAGCAGGGAGGGTGCTGG - Intronic
1184644065 22:45886568-45886590 AGGGGCGGGAAGGAGGGTGCTGG - Intergenic
1184795326 22:46728814-46728836 TGGGGCAGCAGGGTGGGTGCAGG + Intronic
949793649 3:7822630-7822652 GAGTGCTGAAGGGAGGGTGCTGG + Intergenic
950188189 3:10958337-10958359 AGGGGTCTCAGGGAGGGTGCTGG + Intergenic
950715590 3:14845558-14845580 AGGTGATGCAGGCAGGGTGGAGG + Intronic
952952925 3:38538960-38538982 AGGTGCCACAGGGAGCGAGGAGG - Intronic
954680625 3:52344132-52344154 GGGTGCTGCAGGGGAGGTGCAGG + Intronic
958190555 3:90178455-90178477 AGGAGTAGCAGGGAGGGGGCCGG - Intergenic
958434171 3:94077217-94077239 AGGAGGGGCAGGGAGGCTGCAGG + Intronic
961166193 3:124765501-124765523 GTGTTCTGCAGGGAGGGTGCAGG - Intronic
961208020 3:125102875-125102897 AGGGCCCCCAGAGAGGGTGCTGG + Intronic
961351462 3:126307241-126307263 CGGTGACCCAGGAAGGGTGCTGG - Intergenic
961462968 3:127064600-127064622 AGGTGGCGAGGGGAGGGTGCTGG - Intergenic
961473966 3:127135667-127135689 AGGGGCCGCGGGGAGGGTGCGGG - Intergenic
966869962 3:184283972-184283994 AGGTGGGGCAGGCAGGGGGCTGG + Exonic
968616498 4:1579810-1579832 GGGGCCCGCAGGGAGGGCGCAGG + Intergenic
968958493 4:3730731-3730753 AGGGGGCGCAGGGCAGGTGCTGG + Intergenic
968975797 4:3821510-3821532 AGCTGCCTCAGGGAAGGAGCTGG + Intergenic
969339991 4:6534693-6534715 AGGCGCCCGAGGGAGTGTGCGGG - Intronic
969520848 4:7677099-7677121 AGTGGCAGCAGGGAGGGTGGAGG - Intronic
969535706 4:7755107-7755129 AGGGGCGGCAGGGTGGGGGCTGG + Intergenic
973323206 4:48831125-48831147 AGGTACCGCGGGGAGGGGGAGGG - Exonic
973602687 4:52557730-52557752 AGATGAAACAGGGAGGGTGCTGG + Intergenic
975802011 4:78070008-78070030 AGTTGCGGCAGGGAGGGGGTGGG - Intronic
981550373 4:145936950-145936972 AGGCGCCGGAGGGAGGGGTCGGG - Intronic
983879074 4:172912644-172912666 AGAGGCCGCAGCGAGGGTGGGGG + Intronic
984285691 4:177725282-177725304 CAGTGACGCAGGGAGTGTGCAGG - Intergenic
985689132 5:1297433-1297455 AGGGGCAGCTGGGAGGCTGCAGG - Intergenic
985825525 5:2188002-2188024 AGGCGCCACTGGGAGGATGCCGG + Intergenic
985858243 5:2447808-2447830 AGGAGGACCAGGGAGGGTGCAGG + Intergenic
986648917 5:9944992-9945014 AGGTGGAGCACGGAGGGTGCTGG - Intergenic
986866598 5:11996479-11996501 AGGTGACGGAAGGAGGGTGAAGG - Intergenic
987076411 5:14386252-14386274 AGAGGCCCCAAGGAGGGTGCTGG + Intronic
988066204 5:26230571-26230593 TGGGGACACAGGGAGGGTGCTGG - Intergenic
989613005 5:43313295-43313317 AGGTGCCGCGGGCGGGGTGTGGG - Intronic
991539962 5:67716689-67716711 AGGTGCCTCAGGGAGAGAGCTGG - Intergenic
992485378 5:77189643-77189665 TGGTGCAGCAAGGAGGCTGCTGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998612407 5:143703502-143703524 AGGTGCAGGAGGCAGGGCGCTGG + Intergenic
999062813 5:148654171-148654193 GGGGGCGGCAGGGAGGGCGCAGG - Intronic
999279441 5:150355441-150355463 GGGGGCAGCGGGGAGGGTGCTGG - Intergenic
999318961 5:150601461-150601483 ATGTGCCCCAGGGTGGGTGAGGG + Intronic
1001588580 5:172850287-172850309 GGGTGGGGCAGGGAGGGGGCGGG - Intronic
1002339206 5:178503895-178503917 AGGTCCGGAGGGGAGGGTGCGGG + Intronic
1002678135 5:180935727-180935749 AGGTGGGGCTGGGAGGGGGCTGG - Intronic
1003081353 6:3024136-3024158 AGTTGCCGGAGGGAGGGTGGAGG - Intergenic
1005048613 6:21664894-21664916 AGGAGTCGCCGGGCGGGTGCAGG + Intergenic
1006425308 6:33959636-33959658 AGGAGCCACAGAGAGGGTTCTGG + Intergenic
1006946979 6:37791224-37791246 AGGTGCCTAAGGGAGGGTAGGGG + Intergenic
1007273375 6:40655628-40655650 AGCTGAAGCAGGGAGGGAGCTGG + Intergenic
1007710399 6:43819430-43819452 AGATGGGGCAGGGAGGATGCTGG + Intergenic
1007739721 6:44003144-44003166 GGGTGGCGAAGGGAGGGTTCCGG - Exonic
1007765469 6:44157219-44157241 AGGTGCCAGGGGTAGGGTGCAGG - Intergenic
1007932836 6:45707905-45707927 AGGAGCTTCAGGGAGGCTGCTGG + Intergenic
1007933977 6:45716830-45716852 AGGTGCCACAGAGAGGGTGGTGG + Intergenic
1013847516 6:114471841-114471863 AAGAGCCGCTGGGAGGCTGCTGG - Intergenic
1014016248 6:116533718-116533740 AGGTGCTGCAGGGACACTGCAGG + Intronic
1014774310 6:125490925-125490947 TGGTGCTGGTGGGAGGGTGCTGG + Intergenic
1016461445 6:144284079-144284101 AAGTGCTCCAGGGAGGGGGCAGG - Intergenic
1017073759 6:150599956-150599978 AGGTCGGGCGGGGAGGGTGCGGG - Exonic
1017751662 6:157494359-157494381 AGAGCCCGCAGGGAGGGTGGTGG - Intronic
1018260698 6:161967926-161967948 AGCTGTCTCAGGGAGGGTGAAGG + Intronic
1018908395 6:168088247-168088269 AGGTGACGGCGGGAGGGTGGTGG - Intergenic
1019054380 6:169213092-169213114 AGAGGGCGCAGGGAGGGCGCAGG + Intergenic
1019142677 6:169957921-169957943 AGTGGCAGCCGGGAGGGTGCAGG - Intergenic
1019294236 7:265537-265559 AGGTGGTGCAGAGAGGGGGCGGG + Intergenic
1019359638 7:598177-598199 GGGTGCTGGAGGGAGGGTGATGG - Intronic
1019359654 7:598245-598267 GGGTGCTGGAGGGAGGGTGATGG - Intronic
1019359688 7:598389-598411 GGGTGCTGGAGGGAGGGTGATGG - Intronic
1019359704 7:598457-598479 GGGTGCTGGAGGGAGGGTGATGG - Intronic
1019386714 7:761230-761252 AGGCGCTGGAGGTAGGGTGCCGG - Intronic
1019511574 7:1420131-1420153 AGGTGCCGCCGGGAGGAGCCTGG - Intergenic
1019528084 7:1489759-1489781 AGCTGGGGCAGGGACGGTGCTGG + Intronic
1019562023 7:1664183-1664205 TGGTCCCTCAGGGAGGGTCCCGG - Intergenic
1020015424 7:4828835-4828857 AGCTGCAGCAGGGAGGGCCCGGG + Intronic
1023873894 7:44276621-44276643 AGGTGCCCCAGAAAGGGAGCTGG + Intronic
1023981570 7:45073613-45073635 GGGTGCCCCAGGGAGGATGGGGG + Intronic
1023996050 7:45159433-45159455 AGGACCAGCAGGGAGGGTGCAGG + Intronic
1024044205 7:45576021-45576043 ACGGGCCGCAGGGATGGGGCTGG + Intronic
1026986060 7:74555730-74555752 GGGTGGGGCAGGGAGGGGGCAGG - Intronic
1029652965 7:101906337-101906359 AGGAGGAGCAGGGAGGGAGCTGG + Intronic
1030153255 7:106426901-106426923 AGGTGCTGGAGGGAGGGGGGTGG + Intergenic
1030201673 7:106911949-106911971 AGGTGCAGAGTGGAGGGTGCTGG - Intergenic
1030367605 7:108663256-108663278 AGGTGCCACAGGGATGGTGATGG + Intergenic
1032279936 7:130492106-130492128 AGCTGCCGCAGAGGAGGTGCCGG - Exonic
1032441931 7:131948605-131948627 AGATGCCCCAGGGAGGGAGCGGG - Intergenic
1033420218 7:141198858-141198880 TGGGGCCGCAGGCAGGGTGGTGG + Intronic
1035100095 7:156389342-156389364 AGGAACCGCACGGTGGGTGCAGG - Intergenic
1035327291 7:158073365-158073387 AGGTGCCCGGGGGAGGGTGTGGG + Intronic
1035473814 7:159128501-159128523 AGCTGCTGGAGGGAGGGTGAAGG - Intronic
1037616737 8:20526042-20526064 GGATGCAGCAGGGAGGGAGCAGG - Intergenic
1039435350 8:37556151-37556173 GGGTGTGGCAGGGAGGGAGCAGG - Intergenic
1042516324 8:69663001-69663023 AGGTGAGGCAGGGCGGGAGCAGG - Intergenic
1048982685 8:139711444-139711466 AGCTCCCACAGGGAGGGAGCTGG - Intergenic
1049429128 8:142551054-142551076 AGGGTAGGCAGGGAGGGTGCAGG + Intergenic
1049579556 8:143405116-143405138 AGGAGCAGCAGGCAGGGTGGGGG - Intergenic
1049659953 8:143815466-143815488 AGGGGGCGCAGGCAGGGGGCGGG + Intergenic
1052815989 9:33102931-33102953 CTGTGGGGCAGGGAGGGTGCAGG - Intergenic
1052831754 9:33221464-33221486 AGGAAGCGCAGGGAGGGTTCAGG - Intronic
1055550631 9:77429273-77429295 AGGTGACTCAGGGAGCCTGCCGG + Intronic
1056534620 9:87516843-87516865 AGGTGTGGCAGTCAGGGTGCTGG + Intronic
1057492382 9:95531144-95531166 AGGTGGCCCTGGGAAGGTGCAGG + Intergenic
1057667400 9:97056501-97056523 AGGAGGGGCAGGGAGGATGCTGG + Intergenic
1057806180 9:98221333-98221355 AGATGCCGCAGGGATGCTGCTGG - Intronic
1057840592 9:98482942-98482964 AGGTGGCCCAGGGAGAGTGATGG - Intronic
1057880170 9:98787204-98787226 AAGAGCCCCAGGTAGGGTGCAGG - Intronic
1058887169 9:109330304-109330326 GGGTGCTGCAGAGAGGCTGCAGG - Intergenic
1059430308 9:114245981-114246003 AGGTGGTGCATGGAGGGTGCTGG - Intronic
1060938310 9:127528552-127528574 AAGAGCAGCAGGGAGGGAGCTGG - Intronic
1061042946 9:128150161-128150183 AGGTGCCACAGGGACAGAGCTGG + Intronic
1061046673 9:128169031-128169053 AGGTGCTGGGGGGAGGGTGTGGG - Exonic
1061048557 9:128180700-128180722 AGGTGAGGGAGGGAGGCTGCTGG - Exonic
1061329208 9:129881636-129881658 AGGCTCAGCAGGGAGGGAGCAGG - Exonic
1061416408 9:130449479-130449501 AGGTGCCTCTGGGAGGAGGCAGG + Intronic
1062534308 9:137014806-137014828 AGGTGCTGCAGGGGCGGTGGAGG + Exonic
1062542077 9:137045952-137045974 AGGTGCCGCGGGGAGGGCGGAGG + Exonic
1062606572 9:137351221-137351243 GTGTGCCCCGGGGAGGGTGCTGG - Intronic
1185468780 X:370531-370553 TGTGGACGCAGGGAGGGTGCCGG - Intronic
1187226255 X:17376962-17376984 AGGGGCCGCGGGGAGGGTCAGGG + Intronic
1189297688 X:39930325-39930347 GGGTGACGGAGGGTGGGTGCAGG - Intergenic
1190054690 X:47174805-47174827 AGGTGGGGCAGGGAAGGTGGAGG - Intronic
1196483965 X:116182212-116182234 AGGTGCCCCAGGCAGTGGGCTGG - Intergenic
1197572268 X:128163776-128163798 AGGTTCCCCAGTGAGGGTGTGGG + Intergenic
1199637470 X:149826917-149826939 AGGTACCACAAGGAGGGTGGGGG + Intergenic
1200075215 X:153547331-153547353 GGGAGAGGCAGGGAGGGTGCTGG + Intronic
1200125289 X:153810630-153810652 AGGTGCCGCCGTGAGAATGCAGG - Intronic
1200153848 X:153964826-153964848 AGCGCCCGCAGGGATGGTGCTGG - Intronic
1200233941 X:154459332-154459354 AGGAGCCACAGGGACAGTGCTGG - Intronic