ID: 1151498869

View in Genome Browser
Species Human (GRCh38)
Location 17:74476060-74476082
Sequence CTCTGGACACCAAAGCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 4, 2: 15, 3: 25, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151498869_1151498875 3 Left 1151498869 17:74476060-74476082 CCTCCAAGCTTTGGTGTCCAGAG 0: 1
1: 4
2: 15
3: 25
4: 221
Right 1151498875 17:74476086-74476108 TTATTGGGGTTTCATTACATAGG 0: 5
1: 24
2: 67
3: 209
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151498869 Original CRISPR CTCTGGACACCAAAGCTTGG AGG (reversed) Intronic
900823809 1:4910492-4910514 CTCTGGACACTGAGGCTTCGTGG - Intergenic
902164357 1:14557997-14558019 CTTTGGACATCAGAGTTTGGTGG - Intergenic
902822912 1:18954519-18954541 CTCTGAACTCCAGGGCTTGGAGG - Intronic
905170368 1:36106427-36106449 CACTGGCCACCTGAGCTTGGGGG + Intronic
908832721 1:68195720-68195742 CTCTAAACACAAAAGCATGGGGG - Intronic
909992886 1:82245095-82245117 AAATGGACACCAAAGCTTGTTGG - Intergenic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
912908216 1:113729871-113729893 CTCTACATACCAAAGCTTCGGGG + Intronic
912996330 1:114535772-114535794 TTCTGGACACCAAGGCTTGGAGG + Intergenic
916699582 1:167277605-167277627 CTCTGGACAACAAAGGTGGCTGG - Intronic
919483311 1:198115702-198115724 CTATGAACACGAAAGCGTGGAGG - Intergenic
920306198 1:205019716-205019738 ATCTGGTCACCAAGGCTGGGCGG + Exonic
921692129 1:218164417-218164439 GTCTGGCCACCACAGCTTTGGGG - Intergenic
923070754 1:230562442-230562464 CCCTGAACACCAAGGCTTGAGGG + Intergenic
923609777 1:235480100-235480122 ACCTGCACACCACAGCTTGGAGG + Exonic
1063180330 10:3592464-3592486 CTCAGGACTCCAGAGGTTGGAGG - Intergenic
1064980537 10:21162108-21162130 CTCTGGATACCAAAGATTGGTGG + Intronic
1065544966 10:26809770-26809792 CTCTAGACACTGAAGCCTGGTGG + Intronic
1066059170 10:31707127-31707149 CTCTGGACCCGGAAGCTGGGTGG + Intergenic
1066498176 10:35962658-35962680 CACTGGTCAGCAAAGCGTGGTGG + Intergenic
1067497544 10:46773867-46773889 CTCTAGGCACCAAATCTTGGTGG - Intergenic
1067576854 10:47414595-47414617 CTCTGGACAGCCCAGGTTGGTGG - Intergenic
1067597107 10:47566548-47566570 CTCTAGGCACCAAATCTTGGTGG + Intergenic
1069843164 10:71352657-71352679 CACGGGATACCAAAGCTTGGGGG - Intronic
1070140461 10:73734158-73734180 CTCCAGGCACCAAATCTTGGTGG + Intergenic
1070656504 10:78275319-78275341 GTCTGGATACCAAAGCATGGGGG + Intergenic
1071047580 10:81400848-81400870 TTCTGGGCACCAAAGCTTGGTGG - Intergenic
1071797726 10:89024158-89024180 CTCAGGATACCAAAGCTGGAGGG - Intergenic
1071921879 10:90359561-90359583 CTTAGGAAACCCAAGCTTGGAGG - Intergenic
1074475473 10:113769921-113769943 CTCAGGACACCACACCTGGGAGG + Intronic
1075739208 10:124683590-124683612 ATCAGGAGACCAAGGCTTGGGGG + Intronic
1076594987 10:131619739-131619761 CCCAGGACTGCAAAGCTTGGCGG + Intergenic
1076595194 10:131620729-131620751 CCCAGGACTGCAAAGCTTGGCGG - Intergenic
1076823249 10:132952552-132952574 CTCTGCACACCTCAGCTGGGAGG - Intergenic
1077249805 11:1555949-1555971 CTCCAGGCACCAAATCTTGGTGG - Exonic
1077296513 11:1828897-1828919 CTCTGGACCCCATTGCTTGGAGG - Intronic
1077343844 11:2037497-2037519 CTGAGGACTCCAAAGCTGGGCGG + Intergenic
1077881475 11:6354007-6354029 ATCTGGTCACCAAAGCCTGAAGG - Intergenic
1079673978 11:23202411-23202433 CACTGGAGCCCAAAGTTTGGAGG - Intergenic
1081085391 11:38793920-38793942 TTTTGAAAACCAAAGCTTGGTGG + Intergenic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1085515574 11:77109919-77109941 CTCTGGACTCCATGGCTGGGAGG - Intronic
1086476243 11:87178039-87178061 CTCTGAACACTGAGGCTTGGTGG - Intronic
1088498519 11:110457965-110457987 CTTTGGACACCAAAGCAGAGTGG + Intronic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089344046 11:117778768-117778790 CTCTGGCCTCCACAGCGTGGAGG - Intronic
1089956758 11:122578427-122578449 CTCTGGACACTGAGGCTTAGTGG - Intergenic
1090048846 11:123359606-123359628 CACTAGAAACTAAAGCTTGGGGG - Intergenic
1090880494 11:130828106-130828128 CTCTGGAAACCCAAGGCTGGAGG + Intergenic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1202826830 11_KI270721v1_random:92686-92708 CTGAGGACTCCAAAGCTGGGCGG + Intergenic
1094498288 12:31002772-31002794 CTTTGGCCACCAAAACCTGGAGG + Intergenic
1096406007 12:51344749-51344771 CTCTGGAGACCTAAGCCTGTTGG - Intronic
1096482219 12:51950103-51950125 CTGTGTGCACCACAGCTTGGTGG + Intergenic
1097182255 12:57178211-57178233 CTCTGGCCAGCAAGGCTTAGGGG + Intronic
1098729429 12:74014561-74014583 CTCTTGTCACCAAAGCTTCCTGG - Intergenic
1099238929 12:80115901-80115923 CTTGGGACACTGAAGCTTGGTGG - Intergenic
1099781665 12:87202982-87203004 CTCTGGCTACCACAGCTGGGAGG - Intergenic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1102078572 12:110079850-110079872 CTGTGGACACCTAACCTTGAAGG - Intergenic
1104647650 12:130508631-130508653 ACGTGGACACCAAAGCATGGTGG - Intronic
1104738893 12:131158208-131158230 CTCTACACACCAAGGCTTGGGGG + Intergenic
1106080542 13:26496957-26496979 CTCTGGTCACCAAAGCAAAGAGG + Intergenic
1107040007 13:35938264-35938286 CTCTGGAGACCAGAACTAGGAGG + Intronic
1107596760 13:41971317-41971339 CTCTGGATGCCAAAGCTCAGTGG + Intergenic
1108497522 13:51040195-51040217 CTTTGGATACCAACGCTTTGGGG - Intergenic
1108509757 13:51146212-51146234 CTTTGGGTATCAAAGCTTGGGGG - Intergenic
1109182549 13:59231314-59231336 CTATGGAAAACAAAGCTGGGAGG - Intergenic
1112484245 13:99805551-99805573 CTCAGGATACTAAAGCTGGGAGG + Intronic
1112565951 13:100551639-100551661 CCCTGGACAGCACAGCCTGGGGG - Intronic
1118567395 14:67157405-67157427 CTCTGAACTCCAAAGACTGGGGG - Intronic
1119263833 14:73252998-73253020 CTCAGAACACCTAGGCTTGGTGG + Intronic
1119886948 14:78151417-78151439 CTCTGCTCACAAAGGCTTGGAGG - Intergenic
1120083542 14:80242199-80242221 CTCTGGTCACCAAAATTTGTGGG - Intronic
1123911413 15:24971633-24971655 CTCTGGACCGCTAAGCTTGTGGG + Intronic
1123948821 15:25251749-25251771 CACTGGAAATCAAAGCCTGGGGG - Intergenic
1125517921 15:40333148-40333170 CTCTAGACTCTAAAGGTTGGTGG - Intronic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1128784657 15:70385887-70385909 CTGGGAACACCAATGCTTGGTGG + Intergenic
1129637879 15:77341520-77341542 CTGTGAACACCAAAGCTCAGTGG - Intronic
1131705102 15:94985085-94985107 CTATAGACACCAAGGCTTGGTGG + Intergenic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1132297196 15:100748317-100748339 CTGTGGACACCCAAGCTGTGGGG + Intergenic
1134507287 16:14818570-14818592 CTCTGCACTCCCAAGCTTTGTGG + Intronic
1134570067 16:15283416-15283438 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1134694988 16:16217329-16217351 CTCTGCACTCCCAAGCTTTGTGG + Intronic
1134732309 16:16472633-16472655 CCCTGGACACCAAGGCTTGGGGG + Intergenic
1134935127 16:18239330-18239352 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1134976843 16:18577323-18577345 CTCTGCACTCCCAAGCTTTGTGG - Intergenic
1136039542 16:27567125-27567147 CTCAGGACCCCAAATCTTGCTGG - Intronic
1137057054 16:35750898-35750920 CTGTGGACACCAGGGCCTGGAGG + Intergenic
1137356563 16:47771647-47771669 ATCCTGACACCAAAGCCTGGAGG - Intergenic
1137908566 16:52351814-52351836 CTCGGGAAACCACAGCTTGAAGG - Intergenic
1137909496 16:52362165-52362187 TTCTTGACACTATAGCTTGGTGG - Intergenic
1137945538 16:52730407-52730429 CTCTGGACACCAAGGATGGTTGG + Intergenic
1139186990 16:64818494-64818516 CTCGGGACAGAAAAGTTTGGTGG - Intergenic
1140451608 16:75075286-75075308 CACTGCACACCACAGCATGGTGG + Intronic
1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG + Intergenic
1142940726 17:3378264-3378286 CTTTGGACACCAAAGAGTGTGGG - Intergenic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1143405228 17:6673021-6673043 CACTGCACACCACAGCCTGGGGG + Intergenic
1145230149 17:21168027-21168049 CCCTGGACACCACAGCAAGGTGG + Intronic
1145721259 17:27075203-27075225 CATTGGACAGCAAAGCTTTGGGG - Intergenic
1146528864 17:33590859-33590881 CTTTGGAAACCAACTCTTGGAGG - Intronic
1148778088 17:50106931-50106953 CTCTGGCCAGGTAAGCTTGGAGG - Intronic
1150945901 17:69745219-69745241 CACTGGACACAAAGGCCTGGTGG + Intergenic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1151593183 17:75060323-75060345 CAGTGGACACCACAGCTTGTGGG - Intronic
1152925555 17:83086026-83086048 CTCTGGACGCCTGTGCTTGGGGG + Intronic
1153181630 18:2441676-2441698 CTCTGGAAACCGAAGCTCAGTGG - Intergenic
1153759919 18:8320605-8320627 CATTGGACAGCAAAGCTTTGGGG + Intronic
1153799973 18:8660019-8660041 CTCCGGCCACCGAAGCTTGCAGG + Intergenic
1153807055 18:8717797-8717819 CTGTGGACAGCAAAGAGTGGAGG + Intronic
1154293606 18:13131325-13131347 CTCTGGGCACCAAGGCTTTGGGG - Intergenic
1157110463 18:44815910-44815932 CTCTGGACATTGAAGCTGGGAGG - Intronic
1157461752 18:47903329-47903351 CACTGGGCACAAAAGCTTGGAGG + Intronic
1158516821 18:58137811-58137833 CTCTTGACACGTAAGCTGGGTGG + Intronic
1159275940 18:66221711-66221733 CTCTGGACTCCAAAGCTTAGGGG - Intergenic
1161523656 19:4739767-4739789 CTCTGGACCCCAAAGCTTGGTGG + Intergenic
1161733250 19:5975228-5975250 CTCAGGAAATCAAATCTTGGTGG - Intronic
1162970785 19:14180085-14180107 CCCTGGATAACAAGGCTTGGGGG + Intronic
1163292288 19:16386747-16386769 CTCTGCACACGCAAGCCTGGGGG + Intronic
1164906784 19:31974421-31974443 CTGTGGGCACCAAATCTTTGAGG - Intergenic
1165197541 19:34116655-34116677 CTCTGGAGGCTAGAGCTTGGGGG - Intergenic
1166051921 19:40265596-40265618 CTCAGGACACCCATGCTGGGGGG + Intronic
1166998435 19:46730942-46730964 CTCTGGCCACCAAGCCTGGGAGG - Intronic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1168275842 19:55277845-55277867 CTCTGGAGACCAAGGCGAGGAGG + Exonic
1168319165 19:55499048-55499070 CTCTGGATGCCAAGGCTTGGGGG - Intronic
1168542882 19:57227704-57227726 CTCTAGACGTCAAGGCTTGGGGG - Intergenic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
926742911 2:16127016-16127038 ATCTGGTCCCCTAAGCTTGGGGG + Intergenic
927792453 2:26020839-26020861 CTCTGGACCCCAGAGCTGGATGG - Intergenic
928832584 2:35505807-35505829 TTCTGGATACCAAAACTTAGTGG + Intergenic
929335873 2:40744995-40745017 CTCTGGAGACCAGAGTTTGAAGG - Intergenic
929426951 2:41853556-41853578 CTCTGCACACAAGAGCCTGGAGG + Intergenic
929864362 2:45705608-45705630 CTCTAGAAGCCAAAGCGTGGAGG - Intronic
930722567 2:54651859-54651881 CACTGGAAACCAAAGCCTGTTGG + Intronic
932307066 2:70711594-70711616 CTCTGGACAGCAAGGTGTGGGGG + Intronic
935609554 2:105006821-105006843 CTCCGGACACTGAAGCTTGGGGG + Intergenic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
936259620 2:110947717-110947739 CTGCTGACACCAAAGCATGGGGG + Intronic
940974986 2:159932565-159932587 CTGTGGACATCAGAACTTGGGGG - Intronic
941119589 2:161513477-161513499 CCTGGGACACAAAAGCTTGGTGG + Intronic
944347389 2:198685081-198685103 CTTGGGACACTCAAGCTTGGTGG + Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
946099330 2:217305729-217305751 AACTGGACACCAAAGCCTCGGGG - Intronic
946629946 2:221656258-221656280 CTCTGCTCACCAAATCTTGATGG + Intergenic
948344529 2:237284274-237284296 CTCAGGACACCTCAGCTTGCAGG + Intergenic
1169135553 20:3195083-3195105 CTCTGGCCACTAAAGCCTGCTGG + Intronic
1169307875 20:4508788-4508810 CTCTGGACATCGAGGCATGGTGG - Intergenic
1170641485 20:18157898-18157920 CTTTGGAACCAAAAGCTTGGGGG + Intronic
1172301877 20:33856140-33856162 CTCAGGACAAGAAATCTTGGTGG + Intergenic
1172846468 20:37932420-37932442 CTCTGGACACAAGAGCCTGCTGG + Intronic
1172879953 20:38193541-38193563 TTCTGGCCACCAGAGCATGGGGG - Intergenic
1173306195 20:41852363-41852385 CTGTAGACACCAAAGCTAAGAGG - Intergenic
1174465338 20:50712905-50712927 CTGTGGAAACCAAAGGTGGGGGG + Intergenic
1175199201 20:57266421-57266443 CTCTGGACTCCTAGGCTTGCTGG - Exonic
1176055192 20:63141510-63141532 CTCCAGCCACCAAAGCTTGAGGG - Intergenic
1177443780 21:21165290-21165312 TTCTGGACACCCAAGCTCAGAGG - Intronic
1177887281 21:26762023-26762045 CTCAGGACACCTCAGCTGGGAGG + Intergenic
1178027541 21:28485301-28485323 CTCTTGACAATAAAGCTTTGAGG - Intergenic
1178626555 21:34223342-34223364 GTCAGGAGACCAAGGCTTGGCGG + Intergenic
1178935491 21:36858374-36858396 CTCTTGGAAACAAAGCTTGGTGG - Intronic
1180859130 22:19067077-19067099 CTCTGGCCACCCAGGGTTGGTGG + Intronic
1182314370 22:29434586-29434608 CTCTGGACACCATTACTGGGAGG + Intergenic
1184270264 22:43377063-43377085 CTGGGGACAGCGAAGCTTGGAGG - Intergenic
1184558793 22:45248994-45249016 CTCTGCTCACCAAAGCTTTGGGG - Intergenic
1185318938 22:50191349-50191371 GTTAGGACACCCAAGCTTGGAGG + Intronic
949100165 3:133738-133760 CCCTGGACACCAAAGCTTACTGG - Intergenic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
949835467 3:8264837-8264859 TAATGGACACCAAAGCTAGGAGG - Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
953957099 3:47240102-47240124 ATCTGAACACGCAAGCTTGGTGG + Intronic
955144663 3:56304538-56304560 ATCTTGACACCAAAGCTAGTAGG + Intronic
956391107 3:68773419-68773441 CTTTGGACACCAAAGCTTGGTGG - Intronic
958598215 3:96258323-96258345 ATCTGTACACCAAACCCTGGTGG - Intergenic
960067797 3:113393557-113393579 CTCTTGACACCCAAGCTGGATGG + Intronic
960480425 3:118181184-118181206 CTCTGTACACCAAAGGCTGATGG - Intergenic
963026270 3:140922495-140922517 CTCTGGACACCAAACAGAGGTGG - Intergenic
964352313 3:155815361-155815383 CTGTGGACACCAAAGCTTGGGGG + Intergenic
964421633 3:156510129-156510151 CTCTGAAGAGAAAAGCTTGGTGG - Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
966172647 3:177099641-177099663 CTCTAGGCAACAAACCTTGGGGG - Intronic
967576050 3:191094643-191094665 CTCTTGACTCTAAAGCTTGTTGG - Intergenic
969204150 4:5629891-5629913 CTCTGGTCAAGAAAGCTTGTAGG + Intronic
976022947 4:80652770-80652792 CTCTGGACACCAAAACAAGGAGG - Intronic
976630129 4:87228039-87228061 CTCTGGATTCCAAAGCTTGGTGG + Intronic
980044433 4:127972240-127972262 TTATGGACACTAAACCTTGGTGG - Intronic
980352701 4:131701680-131701702 CTCTGCACGCCAAAGGTTAGTGG - Intergenic
980451744 4:132982277-132982299 CTCTGGAGACCATTGCTTTGAGG - Intergenic
982623751 4:157738152-157738174 CTCGGGAAACAAAAGCATGGTGG + Intergenic
983492600 4:168406064-168406086 CTCTGGACACAATTCCTTGGGGG + Exonic
983712942 4:170742323-170742345 TTCTGGATACCAAAGTTCGGTGG - Intergenic
983847440 4:172537423-172537445 AAGTGCACACCAAAGCTTGGGGG - Intronic
984946143 4:184969988-184970010 CTGCTGACACCAAATCTTGGAGG + Intergenic
986424145 5:7613584-7613606 CTTTGCACACCAAAGCTCAGTGG - Intronic
986456617 5:7926931-7926953 CCCTGGAGACCCAAGCCTGGTGG + Intergenic
987428048 5:17795724-17795746 CTCTGGTCACCAAAATGTGGAGG - Intergenic
990257228 5:53983432-53983454 CTCTGGTCTCCAAAGCATGTGGG + Intronic
990703752 5:58503628-58503650 CCATGGAAACCAAAGCTCGGTGG + Intergenic
993406394 5:87516578-87516600 ATCCTGACACCAAAGCCTGGTGG + Intergenic
993536402 5:89092115-89092137 TTCTGGACCCCAAAGTATGGAGG + Intergenic
995379953 5:111520673-111520695 CTCTTTACAACAAAGGTTGGGGG - Intergenic
998391159 5:141787876-141787898 CTCTCGACACCAAAGCCTCCAGG - Intergenic
1000542399 5:162556118-162556140 CCCTGGTGACCAAAGCTGGGGGG + Intergenic
1001250309 5:170141862-170141884 AGCTGGACACCATAGCTGGGAGG + Intergenic
1001743773 5:174074387-174074409 CACTGGAGACCCAAGCTAGGTGG - Intronic
1001923851 5:175621995-175622017 CTCTGGACACCAAGGCTTGGTGG - Intergenic
1002299976 5:178252496-178252518 CCCTGGAGACAAATGCTTGGGGG + Intronic
1003115880 6:3283723-3283745 CTCTGGACACATCAGCTTCGTGG - Intronic
1003168097 6:3698997-3699019 CTCTAGACACCAAAGCTCATTGG + Intergenic
1005218405 6:23558321-23558343 CTCTGGTTACCAGAGGTTGGCGG - Intergenic
1005982640 6:30848136-30848158 CTCTGGACGCCAAAATTTGGTGG - Intergenic
1008512242 6:52287309-52287331 CAAAGGCCACCAAAGCTTGGAGG + Intergenic
1011996228 6:93592192-93592214 CTCCTGACACCATAGCTTTGAGG + Intergenic
1013336850 6:109172258-109172280 ATCTGGACACCAAGGCTTGGTGG - Intergenic
1014170728 6:118276501-118276523 CTCAAGACACCAAAATTTGGTGG - Intronic
1016456338 6:144234774-144234796 CTCTGGGCACTAAGGCTTGGGGG + Intergenic
1017332397 6:153215123-153215145 CACTGGACAGCACTGCTTGGAGG + Intergenic
1017836517 6:158183625-158183647 CTTGGGACACCGGAGCTTGGTGG - Intronic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1023146552 7:37156830-37156852 ATCCTGACACCAAAGCCTGGTGG + Intronic
1024163701 7:46708014-46708036 ATCTGGACACTGAGGCTTGGAGG - Intronic
1026864423 7:73814460-73814482 CGCAGGACACAGAAGCTTGGTGG - Intronic
1029146849 7:98452484-98452506 CTGTGGACACTGAGGCTTGGGGG + Intergenic
1032109426 7:129062887-129062909 CTCTGAACACCAAAGTTCAGTGG + Intergenic
1033659881 7:143395926-143395948 CAGTGGAGAACAAAGCTTGGTGG - Intronic
1035362660 7:158323490-158323512 CAATGGACACAAAAGCTTTGAGG + Intronic
1035987250 8:4448057-4448079 CACTGGACAGCTAAGCTTAGGGG - Intronic
1036826871 8:11983751-11983773 CTCTGGAAACCAGAGGGTGGAGG - Intronic
1038130073 8:24720225-24720247 CTCTGGACTCCAACGCAGGGAGG + Intergenic
1038348211 8:26751516-26751538 CTTCAGACACCAAAGCTTTGGGG - Intronic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1040389582 8:46938163-46938185 CACTGTACACCAAGGTTTGGTGG + Intergenic
1041671071 8:60492473-60492495 CTCTGGACACCTAGGCTTGGAGG - Intergenic
1042170411 8:65985629-65985651 CTCTCAACACCAAACCTTGAGGG + Intergenic
1044221195 8:89672250-89672272 CTCTGGAAACAAAATCATGGTGG + Intergenic
1044810524 8:96057068-96057090 CACTGGGCACCCTAGCTTGGTGG - Intergenic
1046548358 8:115680731-115680753 CTCTGCACTCCAGAGCCTGGGGG - Intronic
1047485650 8:125328511-125328533 ATCTGGACACCAAGGCCTGCTGG + Intronic
1047510067 8:125509135-125509157 CACTGGACACCAACCCTAGGTGG + Intergenic
1047855409 8:128904243-128904265 GACTGGACACCAAAGATTTGGGG + Intergenic
1049929696 9:444535-444557 CTCTGGACACTGAGACTTGGCGG - Intronic
1050892969 9:10848695-10848717 CTCTGGAAATCAAAGCATGTAGG - Intergenic
1051890804 9:21940801-21940823 CTCTGAACCCCAAAGTTTAGAGG + Intronic
1052974078 9:34399095-34399117 CTCTGGACACCAATCCTGGGAGG - Exonic
1056726510 9:89123705-89123727 CTCTGGCCAGGAAAGTTTGGTGG - Intronic
1057288063 9:93776942-93776964 CTCAGGGCACCAAGGCTAGGTGG - Intergenic
1057533989 9:95880341-95880363 CTCTGGACAGCAATGCTTTGTGG - Intronic
1061295631 9:129675388-129675410 CCCTGGCCACCAAAGCTAGAGGG - Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186688913 X:11953974-11953996 CTCTGGACACCAAAGGATGGAGG + Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1188274516 X:28183130-28183152 CCCTGGACAAAAAAGCTTGGAGG + Intergenic
1188582173 X:31727580-31727602 CTCTGGACACAAAAGATGGAAGG + Intronic
1189992956 X:46611876-46611898 ATGTGGACACCATAGCTAGGTGG - Intronic
1190160140 X:48026244-48026266 GTCTGAACACAAAAGGTTGGGGG + Intronic
1193542777 X:82791972-82791994 ATCCTGATACCAAAGCTTGGTGG + Intergenic
1194208501 X:91040023-91040045 CTTGGGACACTCAAGCTTGGTGG - Intergenic
1195704195 X:107726759-107726781 CTATAGACACCAGAGCATGGTGG + Intronic
1199286807 X:146063136-146063158 CCCTGGACTTCAAAGCTAGGAGG - Intergenic
1199848865 X:151711155-151711177 CTCTGGACCCCTAAGCCTGGAGG + Intergenic
1201401886 Y:13612309-13612331 CTTTGGCCACCAATACTTGGTGG + Intergenic