ID: 1151498994

View in Genome Browser
Species Human (GRCh38)
Location 17:74476967-74476989
Sequence GTGTGTGTATGTGGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1785
Summary {0: 1, 1: 0, 2: 12, 3: 215, 4: 1557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151498994 Original CRISPR GTGTGTGTATGTGGGGAAAT TGG Intronic
900122035 1:1052515-1052537 GTGTGTGTGTGTGTGCATATGGG + Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900425260 1:2575444-2575466 GTGTGACTATGTTTGGAAATGGG - Intergenic
900818948 1:4871529-4871551 GTGTGGGTATGTGTGTATATGGG - Intergenic
901091574 1:6645165-6645187 GTGTGACTCTGTGGGGAGATGGG + Intronic
901351577 1:8601617-8601639 GTGTGTGTGTGTGGTGACCTTGG - Intronic
901432804 1:9227698-9227720 TGGTGAGGATGTGGGGAAATTGG + Intergenic
902111761 1:14084966-14084988 ATGTGTGTATGTGTGTAAATTGG + Intergenic
902197397 1:14807839-14807861 CTGTGTCTGGGTGGGGAAATAGG - Intronic
902684854 1:18069497-18069519 TTGTGTGTGTGTGTGGAAACAGG - Intergenic
903006899 1:20304581-20304603 GTGTGTGTGTGTGGTGACAGAGG + Intronic
903026446 1:20432979-20433001 GTGTGTGCATGTGTGGAAGTAGG - Intergenic
903071188 1:20727669-20727691 ATGTGTGTTTGGGGGGAATTTGG - Intronic
903130073 1:21273371-21273393 GTGTGTGTGTGTAGGGTACTGGG + Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903396909 1:23008509-23008531 TTGTGTGTATGTGTGGAGACAGG + Intergenic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
903634787 1:24804505-24804527 GTGTGTGTATGTGGGTGGGTGGG + Intronic
904063538 1:27729762-27729784 TTGTGTGTGTGTGGCAAAATTGG + Intronic
904435311 1:30491016-30491038 GTGTGTGTGTGTGTTTAAATTGG - Intergenic
904470373 1:30732206-30732228 GTGTGAGTGTGTGGGTATATGGG + Intergenic
904867297 1:33590584-33590606 GTGTGTGTGTGATGGGAAATAGG - Intronic
904941161 1:34165575-34165597 GTGTGTGTGTGTGTGGAGAGGGG - Intronic
904955649 1:34281225-34281247 GTGTATGCATGTGGGGATAGAGG - Intergenic
904986070 1:34549819-34549841 GTGAGTGCATGTGGGCAAAGGGG - Intergenic
905045797 1:34999864-34999886 GTGTGTAGATGTGTAGAAATGGG - Intronic
905527616 1:38650984-38651006 GTGTGTGTGTGTGGAGAACGGGG + Intergenic
905593173 1:39182703-39182725 GAGTGAGGATGTGGAGAAATTGG + Intronic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905694446 1:39964648-39964670 GTGTGTGTGTGTGTGTGAATGGG + Intronic
905851543 1:41278564-41278586 GTGTGTGTATGTGTAGGAAAGGG - Intergenic
906022349 1:42641247-42641269 GTGTGTGTGTGTGTGGAGACGGG + Intronic
906072104 1:43024576-43024598 GTGTGTGTGTGTGTGTCAATGGG + Intergenic
906291829 1:44624392-44624414 GTCTGTATATGTGGGGAGCTAGG - Intronic
906675426 1:47690007-47690029 GTGTGTGTGTGTGTGTGAATAGG - Intergenic
906686839 1:47768311-47768333 GAGTGTGTGTGTGTGGAAGTGGG + Intronic
906747800 1:48233886-48233908 GTGTGTGTATGTGTTGGGATGGG - Intronic
906901720 1:49843308-49843330 GTGTGTGTGTGTGTGGAGATGGG + Intronic
906916864 1:50021934-50021956 GTGGGTACATGTGGGGCAATGGG - Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907131069 1:52097489-52097511 GTGTCAGGATGTGGAGAAATTGG + Intergenic
907234560 1:53033677-53033699 TTGTGAGGATGTGGAGAAATTGG + Intronic
907338632 1:53717562-53717584 GTGTGTGTATTGGGTGAAGTGGG - Intronic
907877597 1:58508366-58508388 GTGTGTTCATGTGGGGAAGGAGG - Intronic
907966978 1:59341496-59341518 GTGTGTGTCTGTGCAGAAAATGG - Intronic
908077915 1:60541422-60541444 GTGTGTGTGTGTGTGTTAATAGG + Intergenic
908202533 1:61812456-61812478 GTGTGTGTGTGTGGTGGTATTGG + Intronic
908222757 1:62024647-62024669 GTGTGTGTGTGTTGGGAGGTGGG - Intronic
908376069 1:63542593-63542615 GTATTGGTATGTGGAGAAATTGG - Intronic
908805726 1:67929637-67929659 GTGTGTGTGTGTGTGGTGATGGG - Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909651476 1:77980359-77980381 GTGTGTGTGTGTGTGTAAATTGG + Intronic
909931762 1:81505191-81505213 GTGTGTGTGTGTGTGGGAGTGGG - Intronic
910040591 1:82846848-82846870 GTGTGTGTGTGTGTGTAAATTGG - Intergenic
910165480 1:84323415-84323437 GTGTGTGCATGTGTGCATATGGG + Intronic
910170319 1:84370187-84370209 GTGTGTGTGTGTAGGGGAATGGG - Intronic
910681859 1:89874467-89874489 GTGTGTGTGTGTGTGGTAAGTGG + Intronic
911173804 1:94798095-94798117 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
911688158 1:100800941-100800963 GTGTGTGTGTGTGTGTAACTTGG - Intergenic
911703936 1:100988672-100988694 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
912008747 1:104933833-104933855 GTGTGTGGATGAGGGGAATGTGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912300123 1:108506506-108506528 GTTTGTGTATGGTGTGAAATAGG - Intergenic
913111233 1:115658936-115658958 GTGTGTGTGTGTGTGTACATGGG - Intronic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913514601 1:119593301-119593323 GTCTGTGTATGTGTGGGAGTGGG + Intergenic
914255027 1:145955248-145955270 GTGTGTGTATCTTGGGTAAGTGG + Intronic
914774751 1:150726439-150726461 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
915168395 1:153961550-153961572 GTATGAGTATTTGGGGAGATGGG - Intronic
915209093 1:154293495-154293517 GTGTGTGTGTGTGTGTAATTTGG - Intergenic
915593218 1:156882251-156882273 GTGTGTGTGTGTGGGGTGATGGG + Intergenic
915771068 1:158424745-158424767 GTGTGTGTGTGTGGTGAGAAAGG + Intergenic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
916001256 1:160618408-160618430 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916001616 1:160621872-160621894 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916338413 1:163699588-163699610 GAGTGTGTATGTGGAGAGAGAGG + Intergenic
916412599 1:164560234-164560256 GTGTGTGTGTGTGTGAATATAGG + Intronic
916477942 1:165187458-165187480 GTGTGTGTGTGTGTGTACATGGG + Intergenic
916921395 1:169471456-169471478 GTGTGTGTGTGTGTGGAGACGGG - Intronic
916990824 1:170242922-170242944 GTGTGTGTGTGTGGGGAGGGGGG + Intergenic
917016173 1:170533179-170533201 GTTAGCGTTTGTGGGGAAATTGG + Intronic
917156428 1:172004523-172004545 GTGTGTGTTTGTGTTGAAAATGG + Intronic
917210471 1:172626798-172626820 GTGTGTGTGTGTTGTTAAATAGG - Intergenic
917779002 1:178371313-178371335 GTGTGTGTGTGTGGGAAAGAAGG - Intronic
917926360 1:179792313-179792335 GTGTGTGTGTGTGTGGAGATTGG + Intronic
918093362 1:181315982-181316004 GTGTGTGTATGTTGGGGTAGTGG + Intergenic
918179271 1:182072050-182072072 GTTTGTGTAGGAGGGGCAATGGG + Intergenic
918315463 1:183319064-183319086 TAGTGTGTATGTGGGGGTATGGG - Intronic
918572228 1:186010209-186010231 GTGTGTGTGTGGGGGTACATGGG + Intronic
918642192 1:186856049-186856071 GTGTGTTTGTGTGTGTAAATTGG - Intronic
918645448 1:186899137-186899159 GTGTGTATATGTGTGTAAAGGGG + Intronic
919066512 1:192697914-192697936 GAATGTGTGTGTTGGGAAATAGG - Intergenic
919198798 1:194324497-194324519 GTGTGACTATGTTGGGAGATAGG + Intergenic
919353448 1:196490560-196490582 GTGTGTGTATGTGAGAGAAATGG - Intronic
919742534 1:200989576-200989598 GTGTGTGTATGTGGGGGTAGGGG - Intronic
920293248 1:204939076-204939098 GTGTGTGTGTGTAGGGGGATTGG + Intronic
920439965 1:205973678-205973700 GTGTGTGTATGTGGTGTGAAGGG - Intergenic
920669455 1:207991942-207991964 GTGTGTGTGTGTTGGGGGATGGG - Intergenic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
920862119 1:209718584-209718606 TGGTGAGAATGTGGGGAAATTGG + Intronic
921036259 1:211382023-211382045 GTGTGTGTGTGTGGGTGTATAGG - Intergenic
921277936 1:213537713-213537735 GTGTGAGTTTGTGGGCAAACTGG + Intergenic
921351957 1:214244971-214244993 GTGTGTGTTTGAGGGGCAAGAGG - Intergenic
921712131 1:218383520-218383542 GTGTGTGTATGTGGGGGGTGTGG + Intronic
921723612 1:218500630-218500652 GTATGTGTATGTGAGTATATGGG + Intergenic
921778375 1:219129840-219129862 GTGTGTGTATATGTTGAAATTGG - Intergenic
922232482 1:223699125-223699147 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
922235911 1:223722460-223722482 GTGTGTGTCTGTGTGGAGATGGG + Intronic
922287890 1:224184964-224184986 GTGTGTGTGTGTGTGTAAACGGG - Intronic
922402688 1:225276724-225276746 ATGTGTGTGTGTGTGGAGATAGG - Intronic
922626472 1:227050318-227050340 AGGTGAGGATGTGGGGAAATGGG + Intronic
922818439 1:228467965-228467987 GTGTCTGGCTGTGGGGAAAAGGG + Intergenic
922881457 1:228984415-228984437 GTGTGTGCTTGTGGGCATATGGG - Intergenic
923139988 1:231152985-231153007 GAGGGTGTGTGTGGGGAAAGGGG + Intergenic
923675442 1:236077093-236077115 GTGTGTGTGTGTTTTGAAATGGG - Intergenic
923735133 1:236599677-236599699 GTTTGGGCATGTGAGGAAATAGG - Intronic
923998385 1:239522624-239522646 TTTTGTGCATGTGGAGAAATGGG + Intronic
924048687 1:240058815-240058837 GTGTGTGTGTGTGTGGAGAAGGG - Intronic
924230284 1:241957085-241957107 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
924628539 1:245715629-245715651 ATGTGTGTATGTGCAGAAAGAGG - Intergenic
924745178 1:246825513-246825535 GTGTGTGTATGTGTGTATATGGG + Intergenic
1062789992 10:297227-297249 GTGTGTGTATGTGGTGGGGTGGG - Intronic
1062831453 10:608451-608473 GTGTGTGGGTGTGGGGGGATGGG - Intronic
1063059272 10:2534317-2534339 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1063079791 10:2755238-2755260 ATGTGTGTATGTGTGTATATAGG - Intergenic
1063185713 10:3649433-3649455 GTGTGTGTATGTGTGTAAAATGG - Intergenic
1063232802 10:4082504-4082526 GTGTGTGTATGTGTGTAACAGGG + Intergenic
1063284770 10:4674527-4674549 GTGGTTATTTGTGGGGAAATTGG - Intergenic
1063293828 10:4781078-4781100 GTGTGTGAATGTGTGTAATTTGG - Intergenic
1063506404 10:6604255-6604277 GTGTGTGTGTGTGTGAAAATAGG + Intergenic
1063511458 10:6648360-6648382 GTGTGTGGGTTTGGGGAAAAGGG + Intergenic
1063637378 10:7796411-7796433 GTGGGTGTATGTGTGGGAAGGGG + Intronic
1063761359 10:9081989-9082011 GTGTGTGTGGGTGGGGAGATGGG - Intergenic
1063933619 10:11054507-11054529 GTGTGTGTGTGTGTGTTAATAGG + Intronic
1063950749 10:11221025-11221047 ATGTGTGTGTGTGGTGGAATGGG - Intronic
1064354113 10:14602990-14603012 GTGTGTGTGTGTGGGAAAGAGGG - Intronic
1064597174 10:16957585-16957607 TGGTGTGGATGTGGGGAAAAGGG + Intronic
1064640833 10:17414356-17414378 GAGTGTGGAGGTGGGGATATGGG - Intronic
1064646876 10:17468914-17468936 GTGTGTGTGTGTGGTGACACTGG - Intergenic
1064787849 10:18918124-18918146 GTGTGTCTATGTGAGGCAAGGGG - Intergenic
1064930870 10:20625036-20625058 GTGTGTGTATGTGTGAACATGGG - Intergenic
1065204140 10:23342211-23342233 GTGTGTGTGTGTGTGGCAAGTGG - Intronic
1065279909 10:24125348-24125370 GTGTGTGTGTGTGTGTGAATAGG + Intronic
1065394747 10:25222428-25222450 GTGTGTGGATGTGAGGGAATGGG - Intronic
1065649067 10:27868186-27868208 TTGTGAGTCTGTGGAGAAATAGG + Intronic
1065678137 10:28199871-28199893 GTGTGTGTGTGTGTTTAAATGGG - Intronic
1066094991 10:32063936-32063958 GTGTGTGTGTGTGTGTAATTAGG + Intergenic
1066198110 10:33121429-33121451 TTGTATGTATGTGGAAAAATTGG - Intergenic
1066439659 10:35426230-35426252 GTGTGTGTGTGTGTGTGAATGGG - Intronic
1066536095 10:36393871-36393893 TTGTGAAGATGTGGGGAAATTGG + Intergenic
1066643821 10:37584686-37584708 ATGTGAAGATGTGGGGAAATTGG + Intergenic
1067511535 10:46898898-46898920 GTGTGTGTGTGTGTGGGAAGGGG + Intergenic
1067596016 10:47558557-47558579 GTGTGTGTGTGTGTAGAAATGGG + Intergenic
1068010799 10:51448056-51448078 GTATGTGTGTGTGTGGAGATGGG - Intronic
1068201266 10:53787052-53787074 GTGTTTCTATGTGGGTCAATTGG - Intergenic
1068307610 10:55234117-55234139 GTGTGTATATGTGGGTTAATGGG - Intronic
1068381845 10:56264289-56264311 GTGTGTGTGTGTGTGTTAATTGG - Intergenic
1068390494 10:56390083-56390105 GTGTGTGTGTGTGTGGACAGTGG - Intergenic
1068595330 10:58896786-58896808 GTGTGTGCATGTGTGGATGTGGG - Intergenic
1068695665 10:59965727-59965749 GTGTGTGCCAGTGAGGAAATAGG - Intergenic
1068751206 10:60594598-60594620 GTGTGTGTGTGTGTAAAAATAGG - Intronic
1068765892 10:60763092-60763114 GTGTGTGTGTGTGTGTTAATTGG - Intergenic
1068872162 10:61956908-61956930 GTGTGTGTTTGTGTGTAAATTGG + Intronic
1069021972 10:63499355-63499377 GTGTGAGACTGTGGAGAAATCGG - Intergenic
1069943810 10:71972741-71972763 GTGTGTGTGTCTGGGAAATTAGG - Intronic
1070573021 10:77655774-77655796 GTGTGTGTGTATGTGCAAATAGG - Intergenic
1071090408 10:81911720-81911742 GTGTGTGTGTGTGTGGTAACGGG - Intronic
1071219863 10:83452784-83452806 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1071267924 10:83980806-83980828 GTGTGTGTATGGAGAGAGATGGG - Intergenic
1071616983 10:87083808-87083830 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1071762084 10:88619446-88619468 GTGTGTGTGTGTGTGGCAAGAGG - Intergenic
1071894740 10:90053481-90053503 GTGTGTGTGTGTAGATAAATAGG - Intergenic
1071985870 10:91049703-91049725 GTATGAGAATGTGGGGGAATTGG + Intergenic
1072042883 10:91626270-91626292 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1072155968 10:92723893-92723915 GTGTGTGTGTGTGTAGAAAAAGG - Intergenic
1072492700 10:95923255-95923277 GTGTGTGTGTGTGTGGAGACAGG + Intronic
1072654932 10:97323346-97323368 GTGTGTGAATTTGAGAAAATGGG - Intergenic
1072759009 10:98040568-98040590 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1072875419 10:99168081-99168103 GTGTGTGTGTGTGTGTAAATAGG - Intronic
1073094356 10:100970538-100970560 GTGTGTGTGTGTGTGGTGATGGG - Intronic
1073316969 10:102589095-102589117 GTGTGTGTGTGTATGGAGATGGG + Intronic
1073752284 10:106542401-106542423 GTGTGTGTGTGTAGGGATATAGG - Intergenic
1073839864 10:107485925-107485947 GTGTGTGTATGTGTGTATACAGG - Intergenic
1073854675 10:107660836-107660858 GTGTGTGTATGTGTATAAAGGGG - Intergenic
1074198295 10:111208372-111208394 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1074211285 10:111337623-111337645 CTGTATGTATGTGGGGCAGTAGG + Intergenic
1074255914 10:111802402-111802424 GTGTTTGTATGTGGGCAGGTAGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074929584 10:118110563-118110585 GTGTGTGCATTTGGGGTATTTGG - Intergenic
1075405020 10:122189161-122189183 GTGTGTGTGTGTGCAGAGATTGG + Intronic
1075637092 10:124036655-124036677 GTGTGTGTGTGTGTGCACATGGG - Intronic
1075834240 10:125439977-125439999 GTGTGTGTGTGTGGGGGGGTGGG + Intergenic
1075913130 10:126143222-126143244 GTGTGTGTCTGTGTGGATGTGGG + Intronic
1076054704 10:127362822-127362844 GTGTGTGTATGTGTGGGTGTGGG - Intronic
1076126962 10:127982516-127982538 GTGTGTGTGTGTGTGAAATTTGG + Intronic
1076651591 10:131992875-131992897 GTGTGTGTGTGTGAAGAAACAGG - Intergenic
1076659372 10:132045153-132045175 TTGTGAGGATGTGGGGAAACTGG - Intergenic
1077004842 11:349498-349520 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1077098852 11:812268-812290 GAGGGTGGAGGTGGGGAAATTGG + Intronic
1077340366 11:2023717-2023739 GTGTGCGGGTGTGGGGAGATGGG + Intergenic
1077340387 11:2023822-2023844 ATGTGTGTGTCTGGGGAGATGGG + Intergenic
1077700361 11:4435624-4435646 GTGTGGGTAGGTGGGGTAGTTGG + Intergenic
1077784059 11:5363434-5363456 GTGTGTGTATGTGTGTCAAGAGG - Intronic
1077871639 11:6267741-6267763 GTATGTGTTTGTGGGGATACTGG - Intronic
1078070341 11:8104448-8104470 GTGTGTTTATTTGGGGAAAAGGG + Exonic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078168405 11:8910637-8910659 GTGTGTGTGTGTGTGGACACGGG + Intronic
1078617290 11:12877976-12877998 GTGTGTGTGTGTGTGGAGACAGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1078733149 11:13994431-13994453 GTGTGTGTGTGTGGGGATGGGGG - Intronic
1078733151 11:13994433-13994455 GTGTGTGTGTGTGTGGGGATGGG - Intronic
1078779950 11:14428339-14428361 TTGTGAGAATGTGGAGAAATTGG + Intergenic
1078798438 11:14617707-14617729 GTGTGTGTGTGTGTGTATATGGG + Intronic
1078818524 11:14851520-14851542 GTGTGTGTGTGTGTGTTAATGGG + Intronic
1078845000 11:15112628-15112650 GTGTGTGTGTATTGGGAAGTGGG + Intronic
1078856611 11:15210535-15210557 GTGTGTGTGTGTGGTGGAGTGGG + Intronic
1079052228 11:17172124-17172146 GTGGGAGTATGTGTTGAAATGGG - Intronic
1079077759 11:17394489-17394511 ATGTGTGCATGGGGGCAAATAGG + Intronic
1079105844 11:17571978-17572000 GTGTGTGTATATGAGCAAGTAGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079868530 11:25765451-25765473 TTGTGTGTGTGTGGGGAGAGGGG + Intergenic
1080094253 11:28385805-28385827 GTGTGTGTGTGTGAGGGGATAGG + Intergenic
1080305307 11:30828703-30828725 GTGTGTGTATGTGGTGGAGGGGG - Intergenic
1080397947 11:31907133-31907155 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1080545370 11:33311829-33311851 GTGTGTGTGTGTGTAGAAACAGG - Intronic
1080545374 11:33311902-33311924 GTGTGTGTGTGTGTAGAAACAGG - Intronic
1080545378 11:33311967-33311989 GTGTGTGTGTGTGTAGAAACAGG - Intronic
1080747557 11:35122130-35122152 TGGTGAGGATGTGGGGAAATTGG - Intergenic
1081006127 11:37742875-37742897 GTATGTGTATGTGGGTGCATGGG + Intergenic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1081656632 11:44861786-44861808 GTGTGTGTGTGTGTGAAATTTGG - Intronic
1081892458 11:46555119-46555141 GAGTATGTGTGTGTGGAAATGGG - Intronic
1081961082 11:47138004-47138026 GTGTGTGTGTGTGGGGGTATTGG - Intronic
1082195763 11:49303134-49303156 GTGTGTGTGTGTGTTGGAATGGG - Intergenic
1082558366 11:54589738-54589760 GTTTGTGTCTGCAGGGAAATAGG + Intergenic
1083260060 11:61518040-61518062 GTGTGTGTGCGTGGGGACAGAGG - Exonic
1083268041 11:61556030-61556052 GTGTGTGTGTGTGGGGAGGGGGG + Intronic
1083268503 11:61558557-61558579 GTGTGTGTTTGTTGGGGAACAGG + Intronic
1083685613 11:64373315-64373337 GTGTGTGTGTGTGTGGCCATAGG + Intergenic
1083723622 11:64617174-64617196 GTATGTGTGTGTGTGGAAGTGGG + Intronic
1083774301 11:64886313-64886335 GTGTGTGTATGTGTGTATGTGGG + Intronic
1084131810 11:67141813-67141835 GGGTGTGTATGAGGGGCAAAGGG - Intronic
1084544587 11:69808439-69808461 GTGTGTGTTTGGGGGGTCATGGG - Intergenic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1084676008 11:70635060-70635082 TGGTGAGTATGTGGGGAAACTGG + Intronic
1085168550 11:74427025-74427047 TGGTGAGAATGTGGGGAAATGGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085633697 11:78141162-78141184 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1085745164 11:79108923-79108945 GTGTGTTTGTGTGGGGAATGGGG - Intronic
1085878967 11:80442990-80443012 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1085881425 11:80471661-80471683 GTGTGTGTGTGTGTGGAGATGGG + Intergenic
1086143326 11:83522934-83522956 GTGTTTATATGTGGGTAAAAAGG - Intronic
1086660078 11:89405102-89405124 GTGTGTGTGTGTGTTGGAATGGG + Intronic
1086843992 11:91725387-91725409 GTGCGTTTATGTGGGGACAGTGG - Intergenic
1086893945 11:92290583-92290605 TTTTGTGTGTGTGTGGAAATGGG - Intergenic
1086905400 11:92412839-92412861 GTGTGTGTAGGGGGGTATATGGG - Intronic
1086970857 11:93079100-93079122 GTGTGTGTGTTGGTGGAAATTGG + Intergenic
1086981192 11:93199081-93199103 GTGTATGTATGTGAACAAATTGG - Intergenic
1087281149 11:96212137-96212159 GTGTGTGTGTGTGTGGAAGGGGG + Intronic
1087348772 11:97004603-97004625 GTGTGTGTATGCTGGAGAATGGG - Intergenic
1087551479 11:99656028-99656050 ATGTGTGTATGTGTGTATATAGG + Intronic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1087994184 11:104782970-104782992 GTGTGTGTATGTGTGTGTATGGG + Intergenic
1088405770 11:109476610-109476632 GAGTGTGTGTGGGTGGAAATGGG + Intergenic
1088440876 11:109868538-109868560 GTGTGTGTGTGTTGGGATAATGG - Intergenic
1088642079 11:111882381-111882403 GTGTGGGTTTGTGAGGAAACAGG - Exonic
1088682348 11:112254205-112254227 GTGTGTGTGTGTGTGAAAAGGGG + Intronic
1088719431 11:112579054-112579076 GTGTGTGTGTGTGTGAGAATGGG + Intergenic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1088920586 11:114257653-114257675 GTGTGTGTGTGTCGGGGAGTTGG - Intergenic
1089291857 11:117442518-117442540 GTGTGTGTGTATGGGGGAAGGGG + Intronic
1089298693 11:117484927-117484949 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1089456676 11:118629851-118629873 GTGTGCTTATGTGTGGGAATGGG - Intronic
1089658942 11:119973261-119973283 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1090237393 11:125159658-125159680 GTGTGTGTGTGTGTGGACTTGGG + Intergenic
1090298543 11:125612791-125612813 GTGTGTGTATGTGTGTATGTGGG + Intronic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090562817 11:127951022-127951044 GAATGTATATGTAGGGAAATGGG - Intergenic
1091028477 11:132162337-132162359 GTGTGTGTTTGTGGGGCATGTGG + Intronic
1091129888 11:133136865-133136887 GTGTGTGTGTGTTGGGGAAGGGG + Intronic
1091150885 11:133326975-133326997 GTGTGTGTATGTGGGTGAGGGGG + Intronic
1091196867 11:133738905-133738927 GTGTGTGTATGTGGGTGTGTGGG + Intergenic
1091196941 11:133739194-133739216 GTGTGTGTATGTGGGTGTGTGGG + Intergenic
1091196946 11:133739226-133739248 GTGTGTGTAGGTGTGTATATGGG + Intergenic
1091286343 11:134410764-134410786 GGATGTGTTTGTGTGGAAATGGG - Intronic
1091316186 11:134615626-134615648 GTGTGTGTGTGTGTGTGAATGGG + Intergenic
1202823351 11_KI270721v1_random:78906-78928 GTGTGCGGGTGTGGGGAGATGGG + Intergenic
1202823372 11_KI270721v1_random:79011-79033 ATGTGTGTGTCTGGGGAGATGGG + Intergenic
1091650967 12:2309468-2309490 GTGTGTGTGTGTGGTGTCATAGG - Intronic
1091708657 12:2719779-2719801 GTGTGTGTGTGTGTGGTAAGTGG - Intergenic
1091894904 12:4093992-4094014 GTGTGTGTTTTTTGAGAAATTGG - Intergenic
1091972434 12:4798593-4798615 GTGTGTGTATGTGTGTAGAAGGG - Intronic
1092072498 12:5643057-5643079 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1092180997 12:6446769-6446791 GTGTGTGTGTGTGTGAAAAAGGG - Intronic
1092205754 12:6613493-6613515 GTCTGTGTGTGTAGGGAGATGGG + Intergenic
1092242943 12:6846674-6846696 GTGTGTGTATGTGGGTGTGTGGG - Intronic
1092627443 12:10342154-10342176 GTAACTGTATGTGGGAAAATAGG - Intergenic
1092937632 12:13378826-13378848 GTGTGTGTGTGTGTGAAAATGGG + Intronic
1092948451 12:13477964-13477986 TTGTGTGTATGTGTGTAAACGGG + Intergenic
1092954533 12:13537624-13537646 GTATGTGCATCTGGGGAAAGCGG - Exonic
1093263914 12:16977017-16977039 TGGTGTGGATGTGGAGAAATTGG - Intergenic
1093600380 12:21014424-21014446 ATGTGAGGCTGTGGGGAAATAGG + Intergenic
1093735465 12:22615204-22615226 GTGTGTGTGTGTGTGTAAACTGG + Intergenic
1093814869 12:23533609-23533631 GTCTGTGCATGAGGGGAAAGAGG - Exonic
1093850976 12:24038016-24038038 GTATGTCTTTCTGGGGAAATAGG - Intergenic
1094079193 12:26513741-26513763 GTGTGTGTGTGTGTGATAATTGG - Intronic
1095473409 12:42560759-42560781 GTGTGTGTGTGTGAGAAGATGGG - Intronic
1095551414 12:43445669-43445691 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1095575478 12:43733161-43733183 GTGTGTGTGTGTGGGCAAGATGG - Intronic
1096018050 12:48296402-48296424 GGGTGTGTAGGTGGGAAAGTGGG - Intergenic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096368024 12:51045116-51045138 GTGTGTGTAGCGGGGGAAAGGGG + Intergenic
1096580021 12:52579064-52579086 GAGTGTGTGTGAGGGGAAAAGGG - Intergenic
1096693341 12:53334325-53334347 GTGTGTGTGTGTGTGTAAGTTGG - Intronic
1096716411 12:53494037-53494059 GTGTGTGTGTGTTGGGAGAGAGG - Intronic
1096778714 12:53979646-53979668 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
1096912469 12:54998109-54998131 GTGTGTGTGTGTTGGGATGTTGG - Intergenic
1097090824 12:56503345-56503367 GTGTGTGTGTGTGTGGAGAGGGG + Intergenic
1097201850 12:57285691-57285713 GAGTGTGTTTGTGGGGTAAGGGG + Intronic
1097255383 12:57669842-57669864 TTTTGTGTATGTGTGGAAACGGG - Intergenic
1097322362 12:58240398-58240420 GTGTGTGTGTGTGGGGATAGGGG + Intergenic
1098035151 12:66294165-66294187 GTGTGTGTGTGTGTGGTGATGGG + Intergenic
1098234611 12:68406510-68406532 GTGTGTATGTGTGGGGAATCTGG - Intergenic
1098369015 12:69738419-69738441 GTGTGTGTGTGGCGGGAGATGGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1099084996 12:78234988-78235010 GTGTGTGTATGTGTGTGTATCGG - Intergenic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1099517402 12:83614621-83614643 ATATGTGTATGTGTGTAAATTGG + Intergenic
1099636299 12:85217536-85217558 GTGTGTGTGTGTGTGTATATAGG + Intronic
1099827432 12:87795153-87795175 TTGTGTGTGTGTGTGGAGATAGG - Intergenic
1100042109 12:90332465-90332487 GTGTGTGTATGTGTCGGAAAAGG - Intergenic
1100048435 12:90412980-90413002 GTGTGTTTTTATGGGGACATGGG + Intergenic
1100138031 12:91579147-91579169 GTGTGTGTGTGTGCGTAAAAAGG - Intergenic
1100342873 12:93697872-93697894 GTGGATGGTTGTGGGGAAATGGG + Intronic
1100363695 12:93900118-93900140 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1100363803 12:93900909-93900931 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1100514985 12:95318729-95318751 GTGCGTGTGTGTGTAGAAATGGG - Intergenic
1100704522 12:97185875-97185897 TAGTGTGTATGTGGGGGAAGGGG + Intergenic
1100710586 12:97251983-97252005 GTGTGTGTTTGTTGGGAATGGGG + Intergenic
1100744811 12:97634059-97634081 GTGTGTGTGTGTGTGTATATTGG - Intergenic
1100920601 12:99481673-99481695 TGGTGTGGATGTGGGGAAAGGGG - Intronic
1100931665 12:99617150-99617172 GGGTGAGGATGTGGAGAAATAGG + Intronic
1100985444 12:100198750-100198772 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101355811 12:103976399-103976421 GTGTGTGTGTGTGGGGAGACAGG - Intronic
1101573718 12:105978837-105978859 GTGGGTACATGTGGGGGAATTGG - Intergenic
1101759668 12:107648373-107648395 GTGTGTGTGTGTGTGGAGATGGG - Intronic
1102230570 12:111259073-111259095 TTGTGTGTGTGTGTGGAGATAGG + Intronic
1102572709 12:113836906-113836928 GTGTGTGTATGTGGGGGGGGGGG - Intronic
1102648110 12:114416924-114416946 GTATGTGTATGTGGACAAAGAGG - Intergenic
1102722051 12:115024990-115025012 GTGTGTGTGTGTAGGGAATTTGG + Intergenic
1103143925 12:118577510-118577532 GGGTGAGGATATGGGGAAATGGG + Intergenic
1103200378 12:119083181-119083203 GTGGGTGGTTGGGGGGAAATGGG - Intronic
1103523845 12:121554026-121554048 GTGTGTGTGTGTGTGGAGCTGGG - Intronic
1103565402 12:121812774-121812796 GTGTGTGTATGTGTGCACAGAGG + Intronic
1104012381 12:124940827-124940849 GTGGGTGGACGTGGGGAGATCGG + Intergenic
1104035577 12:125095019-125095041 GTGTGTCTGTGTGTGTAAATAGG + Intronic
1104040401 12:125126447-125126469 GTGTGTGAGTGTGTGTAAATGGG + Intronic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104137202 12:125951923-125951945 GTGTGTGTCTGGTAGGAAATGGG - Intergenic
1104214862 12:126725674-126725696 GTGTGTGTGTGGGGGGGACTGGG + Intergenic
1104272153 12:127292422-127292444 GTGTGTGTGTGTGTGCACATGGG - Intergenic
1104636290 12:130439731-130439753 GTGTGTGTATGTGGGTCTGTGGG + Intronic
1105560073 13:21482076-21482098 GTTTGTATATGTGGTGAAACAGG - Intergenic
1105759316 13:23498853-23498875 GTGCGCGTATGTGGGGATGTGGG + Intergenic
1105778682 13:23687168-23687190 TTGTGTGTATGTGGTGATACTGG + Intergenic
1105788547 13:23773597-23773619 TGGTGTGGATGTGGAGAAATTGG - Intronic
1106219985 13:27738293-27738315 GTGTGTGTGTGTTGGGGAAGAGG + Intergenic
1106346440 13:28883897-28883919 TGGTGAGGATGTGGGGAAATTGG + Intronic
1106408127 13:29491492-29491514 GTGTGTGTATGTGGGGGTGTGGG + Intronic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1106833986 13:33614289-33614311 GTGTGTGTTTCTTGGAAAATTGG + Intergenic
1107185921 13:37520029-37520051 GTGTATGTATGTGTGCATATGGG + Intergenic
1107412251 13:40168812-40168834 GTGTTTGTATGTGGGGCAGGAGG - Intergenic
1107635621 13:42389546-42389568 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1107772334 13:43801919-43801941 GTGTGTGTATGTGGTGGTAGTGG + Intergenic
1107805575 13:44150810-44150832 GTGTGTGTGTGTTGAGAAAGAGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108165745 13:47691427-47691449 GTGTGTGTGTGTGTGAAATTTGG + Intergenic
1108306623 13:49142494-49142516 GTGTGTGTATGTGGAGTGGTAGG - Intronic
1108477387 13:50834550-50834572 GGGAGAGTATGTGGAGAAATAGG + Intronic
1108537813 13:51404049-51404071 GTGTGTGTATTTGTAGAGATAGG - Intronic
1108803079 13:54123323-54123345 GTGTGTGTGTGTGAGGGGATGGG + Intergenic
1109014121 13:56986722-56986744 GAGTGTGTATGTGTTGAAAGTGG - Intergenic
1109201530 13:59436808-59436830 GTGAGTGTATGTGGAAAGATGGG + Intergenic
1109514996 13:63432354-63432376 GTGTGTGTGTGTGTTGAGATGGG + Intergenic
1109548244 13:63858193-63858215 GTGTGTGTTTGTGTGGAAAATGG - Intergenic
1109567905 13:64142604-64142626 TTGTGTGGATGTGGTGAAAAGGG + Intergenic
1109577603 13:64282539-64282561 GTGTGTGTGTGTGTGGTGATGGG - Intergenic
1110000273 13:70189019-70189041 GTGTGTGTGTGTGTGTATATAGG - Intergenic
1110228669 13:73145997-73146019 GTGTGTGTGTGTGTGGAACTTGG + Intergenic
1110778308 13:79435217-79435239 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
1110798680 13:79669988-79670010 GTGTGTGTGTGTTGGGGGATGGG - Intergenic
1111031042 13:82598752-82598774 GTGTGTGTATGTGTGTATAATGG - Intergenic
1111090260 13:83437276-83437298 GTGTGTGTATGTGGGGTGTAGGG - Intergenic
1111498129 13:89080869-89080891 GTGTGTGTGTGTAGTGAATTTGG + Intergenic
1111542237 13:89684293-89684315 GTGTGTGTCTGTGGGGGAAGGGG + Intergenic
1111546687 13:89747292-89747314 GTGTGTATATGTGTGTAAATTGG + Intergenic
1111788144 13:92817187-92817209 GTTTGTGTATGTGTGGGAAGTGG - Intronic
1111860114 13:93693491-93693513 GTGTGTGTGTGTAGGGAGACAGG + Intronic
1112250689 13:97776304-97776326 TTGTGTGGATGTGGTGAAAAGGG - Intergenic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1112268293 13:97946149-97946171 TGGTGGGTATGTGGAGAAATTGG - Intergenic
1112310423 13:98313301-98313323 GTGTGTGTGTTTGGGGGAAGGGG - Intronic
1112447414 13:99477327-99477349 GTGTGTGTATGTGTGCATGTGGG + Intergenic
1112554929 13:100458286-100458308 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1112554934 13:100458353-100458375 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1112610770 13:100952658-100952680 GAGTTTCTATGTAGGGAAATGGG + Intergenic
1112619018 13:101035653-101035675 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1112711538 13:102135010-102135032 GTGTGTGTGTGTGTGGACACGGG - Intronic
1112725619 13:102300906-102300928 GTGTGTGTCTGTGTGCATATTGG - Intronic
1112830136 13:103439480-103439502 GTGTGTGTATGTGGTGTGGTGGG + Intergenic
1112851651 13:103713417-103713439 GTGTGAGTGTGTGGGGAGAAAGG - Intergenic
1112861870 13:103839151-103839173 GTGTGTGTGTGTGTGTTAATGGG - Intergenic
1112869456 13:103951734-103951756 GCATGTGGATGTGGAGAAATAGG - Intergenic
1112883483 13:104138048-104138070 GTGTGTGTGTGTGGTGGTATGGG + Intergenic
1113468414 13:110527886-110527908 GTGTGTGTATTTGTAGAGATAGG - Intronic
1113535149 13:111060343-111060365 GTGTGTGTGTGTGTAGAGATTGG - Intergenic
1113571048 13:111358293-111358315 GTGTGTGTGTGGTGGGGAATAGG + Intergenic
1113717328 13:112521115-112521137 GGGTGTGTATGTGGGTCAGTTGG - Intronic
1113874146 13:113584308-113584330 GTGTGTGCATGTGGGGGAGCGGG - Intergenic
1114039826 14:18667412-18667434 GTGTGTGTTTGTGGGGGTAAGGG + Intergenic
1114119819 14:19658856-19658878 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
1114463444 14:22903167-22903189 TTGTGTGTATGTGGGGGTGTGGG - Intronic
1114715778 14:24822339-24822361 GTGTGTATATGTGAGGCAAGAGG - Intronic
1114756043 14:25261187-25261209 GTGTGTGTGTGTGTTGAGATGGG - Intergenic
1115353580 14:32423349-32423371 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1116052379 14:39820665-39820687 TTGAGAGTATGTGGAGAAATAGG - Intergenic
1116318319 14:43426753-43426775 GTGTTTATATGTGGGAAAATAGG - Intergenic
1116319151 14:43437378-43437400 GTGTATGTGTGTGGGTATATGGG + Intergenic
1116751335 14:48889236-48889258 GTGTGTGTGTGTGTAAAAATGGG + Intergenic
1116870546 14:50065712-50065734 GTGTGACTGTGTGGGGAAATGGG - Intergenic
1116870787 14:50067648-50067670 GTGTGACCGTGTGGGGAAATGGG - Intergenic
1117321741 14:54630946-54630968 GTGTGTGTGTGATGAGAAATCGG + Intronic
1117438940 14:55742648-55742670 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
1117825695 14:59701177-59701199 GTGTGAGGATGTGGAGAAATTGG + Intronic
1118071218 14:62248604-62248626 GTGTGTGTGTGTGTGGAACGGGG + Intergenic
1118204133 14:63705789-63705811 TGGTGAGTATGTGGGGAAATTGG + Intronic
1118247758 14:64127897-64127919 ATGTGTGTATGTGAAAAAATGGG - Intronic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1118366689 14:65102426-65102448 GTGTGTGTGTGGGGGGGACTCGG - Exonic
1118665862 14:68068749-68068771 TGGTGTGTATGTGGAGGAATCGG - Intronic
1118682763 14:68260305-68260327 GTGTGTGTGTGTGTGGAGAGGGG + Intronic
1119175760 14:72566622-72566644 GTGTGTGTGTGTGTGATAATGGG - Intergenic
1119188786 14:72664325-72664347 GTGTGTGTGTGTTGGGAGGTCGG - Intronic
1119317820 14:73710107-73710129 GTGTGGGTGTGAGGAGAAATGGG + Intergenic
1119416905 14:74477029-74477051 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119416917 14:74477108-74477130 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119736029 14:76982794-76982816 GTGTGTGTGTGTGTAGAGATAGG + Intergenic
1119887072 14:78152125-78152147 AGGTGTTTATGTGGGGAAAAAGG + Intergenic
1120063981 14:80018241-80018263 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1120614603 14:86688310-86688332 GTGTGTGTAGGTGTGTATATGGG - Intergenic
1120631594 14:86898375-86898397 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1121012126 14:90526161-90526183 TTGTGAGGACGTGGGGAAATTGG - Exonic
1121118475 14:91360245-91360267 GTGTGTGTGTGTGTGAAGATGGG - Intronic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121660754 14:95633248-95633270 GTGTGTGTGTGTTGGGGGATGGG + Intergenic
1121666002 14:95672889-95672911 GTGTGTGTATGTTGGGGGTTGGG + Intergenic
1121849219 14:97204119-97204141 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
1121958950 14:98240773-98240795 GTGTGTATATGTGGGGAAGGAGG + Intergenic
1122021474 14:98841298-98841320 GTGTGTGTATGTGTATATATGGG + Intergenic
1122057790 14:99116634-99116656 GTGTCTGTGTGTTGGGGAATGGG - Intergenic
1122277536 14:100602756-100602778 GTGTGTGTATGTGGGTGTGTGGG + Intergenic
1122460409 14:101889709-101889731 GTGGGTGTCAGTGGGGAACTGGG + Intronic
1122708627 14:103638816-103638838 GTGTGTGTATGTATGAACATAGG + Intronic
1122817881 14:104322668-104322690 CTGGGAGTATGTGGGGAGATGGG - Intergenic
1122966732 14:105133254-105133276 GTGTGTGTGTGTGTGCAGATAGG + Intergenic
1123432656 15:20231763-20231785 GTGTGTGTATGTGTGTAGAGAGG - Intergenic
1123702218 15:22923473-22923495 TGGTGTGGATGTGGGGAAACTGG + Intronic
1123830477 15:24131107-24131129 GTGTCTGTATGTGTGTAAAATGG + Intergenic
1123841338 15:24250562-24250584 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123850728 15:24353713-24353735 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123855608 15:24407953-24407975 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123864138 15:24500134-24500156 GTGTGTGTATGTGTATAAAATGG + Intergenic
1124024373 15:25951196-25951218 TTGTGTGTGTGTGTGGAGATGGG + Intergenic
1124270899 15:28279608-28279630 GTGTGTGTGTGTGTGGAGATGGG - Intronic
1124861431 15:33445650-33445672 GTGTGTGTTGGTGGGGGAAAGGG - Intronic
1125443350 15:39726828-39726850 GTGTGTGTATGTGAAGACCTGGG - Intronic
1125764948 15:42128535-42128557 GTGTGTGTGTGTGTGGAGATAGG - Intergenic
1125932566 15:43611024-43611046 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1125945664 15:43710486-43710508 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1126062181 15:44793293-44793315 TGGTGAGAATGTGGGGAAATGGG + Intergenic
1126117122 15:45218319-45218341 TTGTGTGTGTGTGTAGAAATGGG + Intergenic
1126532291 15:49724675-49724697 GTGTGTGTGTGTGGGCAGTTGGG - Intergenic
1127101362 15:55568352-55568374 GTGTGTGTGTGTCTGTAAATGGG + Intronic
1127305061 15:57697326-57697348 GTGTGTGTGTGTGGAGAGATGGG - Intronic
1127360004 15:58237042-58237064 GTGTGTGTGTGTGTGTGAATGGG + Intronic
1127577322 15:60304297-60304319 GTGTGTGTGTGTTGGGAAATAGG - Intergenic
1127998404 15:64169132-64169154 GTGTGTGTGTGTGTGGAAGCAGG + Exonic
1128211702 15:65908029-65908051 GTGTGTGTATATGCTGGAATGGG + Intronic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1128688414 15:69704792-69704814 GTGTCTTCATGTGGCGAAATGGG + Intergenic
1128961347 15:72008459-72008481 GTGTGTGTGTGTGTGTGAATGGG + Intronic
1129054676 15:72810573-72810595 ATGTGAGTCTGTTGGGAAATGGG + Intergenic
1129083076 15:73058583-73058605 GTGTGTGTATGTGGGGGTCAGGG + Intronic
1129957239 15:79650188-79650210 GTGTGTGTGTGTGTGAAAAGTGG - Intergenic
1130261433 15:82356983-82357005 GTGTGTGATTGTGGGGAAGGAGG + Intergenic
1130279803 15:82512028-82512050 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130471177 15:84228214-84228236 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130478671 15:84342784-84342806 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130493099 15:84445347-84445369 GTGTGTGATTGTGGGGAAGGAGG + Intergenic
1130584842 15:85172828-85172850 GTATGTGTATTGGGGGAAATGGG + Intergenic
1130593471 15:85232851-85232873 GTGTGTGATTGTGGGGAAGGAGG - Intergenic
1130613595 15:85382486-85382508 GTGTGTGATTGTGGGGAAGGAGG + Intronic
1130858114 15:87859983-87860005 GTGTGTGTATGTATGGACATAGG - Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131107805 15:89746650-89746672 GTGTGTTTGTGTGGGGAGGTAGG - Intergenic
1131107831 15:89746780-89746802 GTGTGTGTGTGTGGGGAGGTAGG - Intergenic
1131107862 15:89746926-89746948 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
1131325017 15:91434522-91434544 GTGTGTGTGTGTGTGCATATGGG + Intergenic
1131518839 15:93098373-93098395 GTGTGTGAGTGTGGGGAAGGAGG + Intergenic
1131619410 15:94051357-94051379 GTGTATGTATTTGGGGAAGAGGG - Intergenic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1131971458 15:97897537-97897559 GTGTGTGAGTGTTGGGAAAAAGG - Intergenic
1131979263 15:97979652-97979674 GTCTGTGGATGTGGGGAGCTGGG - Intergenic
1131980356 15:97988259-97988281 GTGTGTGTATGTGTGTGTATGGG + Intergenic
1132091660 15:98952289-98952311 GTGTGTGTTGGTGGGGTACTGGG - Intronic
1132166954 15:99602718-99602740 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1132644803 16:993946-993968 GGGTGGGTGTGTGGGTAAATGGG - Intergenic
1132975857 16:2710901-2710923 GTGTGTGTATGTGTGCACATGGG + Intergenic
1133074152 16:3266858-3266880 GTGTGTGTGTGTTTGGAGATAGG - Intronic
1133163413 16:3928160-3928182 TTGTATGTATGCGGGGAAATGGG + Intergenic
1133392304 16:5420385-5420407 GTGTGTGTGTGTGTGTATATGGG - Intergenic
1133504956 16:6402645-6402667 GTGTGTGTATGTGTTTACATAGG - Intronic
1133542763 16:6772440-6772462 GTGTATGTATGTGTGGGCATGGG + Intronic
1133542768 16:6772471-6772493 GTATGTGTATGTGTGGGTATGGG + Intronic
1133542812 16:6772829-6772851 GTGAGTGTATGTGTGGGCATGGG + Intronic
1133542860 16:6773172-6773194 GTGTGTGTGTGTGTGGGCATGGG + Intronic
1133542884 16:6773335-6773357 GCATGTGTATGTGTGGATATGGG + Intronic
1133542905 16:6773461-6773483 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542919 16:6773556-6773578 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542929 16:6773632-6773654 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542934 16:6773679-6773701 GTATGTGTATGTGTGGGCATGGG + Intronic
1133542939 16:6773712-6773734 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542944 16:6773747-6773769 GTGTGTGTATGTGTGGGCGTGGG + Intronic
1133610763 16:7431410-7431432 GTGTGTGTGTGTGTGTAGATGGG + Intronic
1134168186 16:11947261-11947283 GTGTGTGTGTGTGTGTACATAGG + Intronic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1135171113 16:20184566-20184588 GTGTGTTTATGTGTGGGTATGGG + Intergenic
1135205640 16:20481568-20481590 GGGTGTGTGGGTGGGGAAGTGGG + Intronic
1135213272 16:20542245-20542267 GGGTGTGTGGGTGGGGAAGTGGG - Intronic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1135819744 16:25672865-25672887 GTGTGTGTGTGTGTGGAGATAGG - Intergenic
1135921716 16:26655653-26655675 GTTTGTGTATTTTGTGAAATTGG + Intergenic
1136177528 16:28527969-28527991 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1136562651 16:31049451-31049473 GTGTGTGTGTGTGTAGAAATGGG + Intergenic
1136851986 16:33619435-33619457 GTGTGTGTGTGTAGGGAGAGGGG + Intergenic
1136991784 16:35156743-35156765 TGGTGTGGATGTGGTGAAATAGG + Intergenic
1137267745 16:46883210-46883232 GTGTGTGTGTGTTGGGATGTGGG + Intergenic
1137561096 16:49502899-49502921 GTGTGTGTATGCGTGCACATGGG - Intronic
1137580079 16:49628212-49628234 GTGTGAGTATGTAGATAAATGGG - Intronic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137813039 16:51371189-51371211 GTGTGTGTATGTGTGAAGACGGG - Intergenic
1137813769 16:51378418-51378440 GTGTGTGTGTGTGGTGAATGTGG + Intergenic
1137978312 16:53049344-53049366 GTGTGTGTGTGTGTGTAAACAGG + Intergenic
1138565894 16:57832647-57832669 GTGTGTGTGTGTTGGGGAAAGGG - Intronic
1138637969 16:58358259-58358281 GTTTGTGGATGTGGTGAAAAGGG - Intronic
1138660391 16:58513182-58513204 GTGTGTGTGTGTGTGTACATCGG + Exonic
1138762089 16:59556883-59556905 GTGTGTGTATGTGTGTGTATTGG - Intergenic
1139151169 16:64383219-64383241 GTGTGTGTGTGTGTGAAGATAGG - Intergenic
1139235820 16:65337714-65337736 GGGTGAGCATGTGGGAAAATTGG + Intergenic
1139265372 16:65633650-65633672 GTGTGTGTGTGTGTGAAAATGGG - Intergenic
1139314104 16:66053420-66053442 GTGTGTGTGTGTGTGTATATTGG - Intergenic
1139314110 16:66053568-66053590 GTGTGTGTAGGTAGGTAAATAGG - Intergenic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1140045787 16:71439731-71439753 TGGTGAGAATGTGGGGAAATTGG + Intergenic
1140139582 16:72242862-72242884 GTGTGTGTTTGTGTGCAAAGGGG + Intergenic
1140465975 16:75183034-75183056 GTGTGAGGATGTGGAGAAAAAGG + Intergenic
1140494558 16:75373232-75373254 GTGTGTGTAAGTGTTGAAATGGG - Intronic
1140586429 16:76298518-76298540 GTGTGTGTGTGTGAGGTAAGGGG + Intronic
1140842905 16:78858158-78858180 GTGTGTGTGTGTGTATAAATTGG + Intronic
1140843957 16:78868954-78868976 GTGTGTGTCTGTGTGTACATGGG - Intronic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1141160521 16:81626455-81626477 GTGTGTGTATGTGTGGCATGTGG + Intronic
1141167878 16:81672382-81672404 GTGTGTGAATGTGTGCACATGGG + Intronic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1141496289 16:84412568-84412590 GTATGTGTGTGTGTGGAGATGGG + Intronic
1141570449 16:84930640-84930662 GTGAGTGGATGTGGGTGAATGGG + Intergenic
1141830519 16:86507768-86507790 GTGTGTGTGTGTGTGGCAAATGG - Intergenic
1141843277 16:86588748-86588770 GTGTATGTAAGTGGAGAAAATGG - Intergenic
1142139557 16:88466758-88466780 GGGTGTGTATGTGGGGGAGGGGG + Intronic
1142257735 16:89023427-89023449 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1142774620 17:2126879-2126901 GTGCGTGTGTGTGTAGAAATAGG - Intronic
1143019070 17:3907317-3907339 GTGTGTGTGTGTTGGGGTATGGG + Intronic
1143173933 17:4945833-4945855 GTGTGTGTATGGGGAGGAAAGGG + Exonic
1143237151 17:5412653-5412675 GTGTGTGTATGTGGGGGGGTGGG - Intronic
1143435391 17:6920776-6920798 GTGTGTGTGTGTGTGAAGATGGG + Intronic
1143583062 17:7837410-7837432 TTGTGTGTATGCGGGTGAATCGG + Intergenic
1144075770 17:11718046-11718068 GTGTGTGTGTGTGTAGATATGGG + Intronic
1144171449 17:12663475-12663497 GTGTGTGTATGTGTGGAGTGTGG - Intergenic
1144498755 17:15767609-15767631 GTGTGTGTATCTGGGCACACAGG - Intergenic
1144527613 17:16003702-16003724 GTGCGTGTGTGTGGGTATATGGG + Intronic
1144583747 17:16475310-16475332 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1144655377 17:17031904-17031926 ATGTGTGTTTGTGGGCAACTGGG - Intergenic
1145016318 17:19400669-19400691 TTGTGTGTGTGTGGGGTAGTGGG + Intergenic
1145049877 17:19651015-19651037 GTGTGAGTATGTGTGTATATAGG + Intronic
1145065915 17:19761275-19761297 TTGTGAGGATGTGGAGAAATTGG - Intergenic
1145162138 17:20582643-20582665 GTGTGTGTATCTGGGCACACAGG - Intergenic
1145264744 17:21374358-21374380 GTGTGTGTGTGTGTGGGAAGGGG + Intergenic
1145411417 17:22669304-22669326 GTGTGTGTGTGGGGGGTAAGTGG + Intergenic
1146032199 17:29375945-29375967 GGGTGTGTATGTGGGGTGGTAGG + Intergenic
1146379475 17:32318177-32318199 GTGTGTGTGTGTGTGGAGACAGG - Intronic
1146407447 17:32551549-32551571 GTGTGTGTGTGTGTGGCAGTGGG - Intronic
1146522609 17:33537853-33537875 GTGTGTCTAGGAGGGGCAATAGG + Intronic
1146665279 17:34698122-34698144 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1146810086 17:35896307-35896329 GAGTGTGTATGTGTGGGACTGGG + Intergenic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1147211541 17:38875077-38875099 GTGTGTGTGTGTGAGAAAGTGGG + Intronic
1147219264 17:38919110-38919132 GTGTGGGTATGTGAGGAGCTGGG - Exonic
1147395039 17:40135849-40135871 GTGTGTGTGTGTGTGGCTATGGG + Intronic
1147543959 17:41384391-41384413 GTGTGTGTATGTTTAGATATAGG + Intronic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1147816867 17:43216625-43216647 GTGTGTGGATGTGTGGTAGTGGG + Intronic
1147939023 17:44032544-44032566 GTGTGTATATTTGGGGAGAAAGG + Intergenic
1147968362 17:44206407-44206429 GTGTGTGTGTGTGTGTAAAGGGG - Exonic
1148055482 17:44792056-44792078 CTGTGTGTGTGTGTGGAAATGGG + Intergenic
1148445476 17:47734465-47734487 GTGTGTGTACGGGGGGAGATTGG + Intronic
1148455705 17:47810266-47810288 GTGTGTGTATGTGTACACATTGG + Intronic
1148568192 17:48646331-48646353 AGGTGTGTGTGTGGGGAAAGGGG - Intergenic
1148789848 17:50167034-50167056 GTGTGTGTGTGAGGGGATGTGGG - Intronic
1148928178 17:51106094-51106116 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1148991730 17:51672185-51672207 CTGTGTGTATTTGGGGGAAGAGG - Intronic
1149133258 17:53334011-53334033 GTGTGTGTGTGTGTAGACATGGG - Intergenic
1149238229 17:54617989-54618011 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1149340409 17:55680255-55680277 GTGTGTGTGTGTGTGAAAACTGG + Intergenic
1149345014 17:55725959-55725981 AAGTGTGTATGTAGGGGAATGGG + Intronic
1149351692 17:55795037-55795059 GTGTGTATGTGTGTGGAATTGGG - Intronic
1149481591 17:57007810-57007832 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1149799475 17:59553633-59553655 GTGTGTGTGTGTGTGTATATAGG + Intergenic
1150043525 17:61888577-61888599 GTGTGTGTGTGTGTGGAGATGGG + Intronic
1150301867 17:64053862-64053884 GACTGTGTATGTGGTTAAATGGG + Intronic
1150340229 17:64360606-64360628 GTGTGTGTGTGTGGTGAGAAGGG + Intronic
1150636349 17:66915870-66915892 GTGTGTGTGGGTGAGGAGATTGG - Intergenic
1150653767 17:67026356-67026378 GTGTGTGTATTTGAGGAATGTGG + Intronic
1150653774 17:67026427-67026449 GTGTGTGTATTTGAGGAATGTGG + Intronic
1150689880 17:67355961-67355983 GTGTGTGTGTGTGTAGAAATGGG - Intronic
1151066313 17:71154224-71154246 GTGTGTGTGTGTGTGTGAATAGG - Intergenic
1151081636 17:71335993-71336015 GTGTGTGTGTGTGTTGAAACAGG - Intergenic
1151174123 17:72273111-72273133 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1151282528 17:73087643-73087665 GTGTGGGTATGTGGGACTATAGG + Intronic
1151343220 17:73485187-73485209 GTGTGTGTATGTGGAGAGGTGGG + Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151516680 17:74601010-74601032 GTGTGTGTGTGTGGGGGTGTGGG + Intergenic
1151703421 17:75754907-75754929 GTGTGTGTATGTTGGAGAATGGG - Intronic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152011084 17:77717785-77717807 GTGTGTGTGTGTGGAGAGAGAGG + Intergenic
1152449201 17:80365740-80365762 CTGTGTGGGTGTGGGGAAAAGGG - Intronic
1152493296 17:80652499-80652521 GTGTGTGCATGTGTAGAGATAGG + Intronic
1152815345 17:82404477-82404499 GTGTGTGGACGTGGGGAGAGGGG + Intronic
1153047945 18:873591-873613 ATGTGTGTTTGTGTGGAAAGAGG + Intergenic
1153110113 18:1576427-1576449 GTGTGTGTGTGTGTGGTAGTTGG - Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153508307 18:5826480-5826502 GTGTGTGTGTGTGTGAAAAATGG + Intergenic
1154080400 18:11250533-11250555 GTGTGTGTGTTAGGGGAAGTAGG - Intergenic
1154291509 18:13111982-13112004 TGGTGAGGATGTGGGGAAATTGG + Intronic
1154510994 18:15101973-15101995 GTGTGTGTTGGAGGGGAAAGAGG + Intergenic
1155193115 18:23448926-23448948 TGGTGTGGATGTGGAGAAATGGG - Intergenic
1155387632 18:25297066-25297088 GTGTGTGTATGTGTGTGTATGGG - Intronic
1155496359 18:26446815-26446837 GTGTGTGTGTGTGTAGAAATGGG - Intergenic
1155542392 18:26882011-26882033 GTGTGTGTGTGTGTGGACCTAGG + Intergenic
1155572213 18:27207517-27207539 GTGTGTGTGTGTGGGGGGGTGGG - Intergenic
1155611265 18:27670524-27670546 GTGTGTGTGTGTGTGTAAACCGG + Intergenic
1155643185 18:28044865-28044887 GTGTGTGTGTGTGTGTAAACAGG + Intronic
1155753505 18:29459540-29459562 GTGTGTGTGTGTGTGGCAGTGGG + Intergenic
1155932462 18:31721898-31721920 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1156092051 18:33483097-33483119 GTGTGTGTATGTGGAAAAGTTGG - Intergenic
1156099846 18:33579365-33579387 GTGTGTGTGTTTGGTGAAGTTGG + Intronic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1156248242 18:35324308-35324330 GTGTATGTATTAGGGGAAAAAGG + Intergenic
1156310020 18:35913233-35913255 GTGTGTGTGTGTGGTGGGATGGG - Intergenic
1156527595 18:37781254-37781276 GTGTGTGTATGTGTGTCTATAGG - Intergenic
1156627817 18:38931013-38931035 GTGTGTGTGTGTGTGGAGGTGGG + Intergenic
1157022449 18:43801925-43801947 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
1157441892 18:47717951-47717973 GTGTGTGTGTGTGTGTAAATAGG + Intergenic
1157751756 18:50184865-50184887 GTGTGTGTGTGTGTAGAGATAGG - Intronic
1157894137 18:51448026-51448048 GTGTGTGTGTGTGTGGAGTTTGG + Intergenic
1157969026 18:52244117-52244139 GTGTGTGAATGTGGGTTAAGTGG - Intergenic
1158107792 18:53905103-53905125 GTGTTTCTGTGTGGGGAAAGGGG - Intergenic
1158149271 18:54349209-54349231 GTGTGTGTATTTGGGAACTTTGG + Intronic
1158334726 18:56403407-56403429 GTGGTTGAATGGGGGGAAATTGG - Intergenic
1158386224 18:56995229-56995251 ATGTGTGTTTCTGAGGAAATAGG - Intronic
1158447049 18:57530774-57530796 TTGTGTGTATGTGGGGGAGGAGG - Intergenic
1158482455 18:57834098-57834120 GTGTGTGTGTGTGTTGAAAGGGG + Intergenic
1158559499 18:58502127-58502149 GTGTGTGTGTGTGTGGAGATGGG - Intronic
1158715810 18:59878791-59878813 GTGTGTGGAGGTGGGGAATAAGG - Intergenic
1158965055 18:62615208-62615230 CTGTGTGTGTGTGTGAAAATGGG + Intergenic
1159034053 18:63260231-63260253 GTGTGTGTATGTATGGAATGAGG - Intronic
1159066633 18:63575897-63575919 GGGTGTGGATGTGAAGAAATAGG - Intergenic
1159220382 18:65455822-65455844 GTGTGTGTGTGTGTGGAGAGGGG + Intergenic
1159289679 18:66399997-66400019 GAGTGTGTATGTAGGCAAAAAGG + Intergenic
1159548672 18:69872078-69872100 GTGTGTGTGTGTGGTGCATTTGG + Intronic
1159639521 18:70847444-70847466 GTGTATGTATGTGAGTAATTTGG + Intergenic
1159689456 18:71467927-71467949 GTACGGGGATGTGGGGAAATGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1159830818 18:73276369-73276391 GTGTGTGTATGTGAGGCAACGGG - Intergenic
1159966795 18:74602894-74602916 GTGTGTGTGTGAGGGGAGTTGGG + Intronic
1160061093 18:75529419-75529441 GTGTGTGTGTGTGTTAAAATTGG - Intergenic
1160278390 18:77461754-77461776 GTGTGTGTGTGTGTGCATATAGG + Intergenic
1160401890 18:78617446-78617468 GTGTGTGTGTGTGTGGGAAAAGG - Intergenic
1161556725 19:4946963-4946985 TGGTGAGAATGTGGGGAAATTGG - Intronic
1161763135 19:6189012-6189034 GTGTGTGATTCTGGGGCAATAGG + Intronic
1161838378 19:6663499-6663521 GTGTGTGTATGTGTGTAACCAGG + Intronic
1161956684 19:7499952-7499974 GTGTGTGTGTGTGTGGAGACGGG + Intronic
1162298862 19:9832383-9832405 GTGTGTGGGTGTGGGCACATGGG + Intergenic
1162311703 19:9912101-9912123 CGGTGTGTATATGGGGGAATGGG - Intronic
1162340814 19:10090612-10090634 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1162529131 19:11225512-11225534 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1162901594 19:13798317-13798339 GTGTGTGTGTGTGTAGACATGGG + Intronic
1163099876 19:15088477-15088499 TTGTGTGTGTGTGTGGAGATAGG - Intergenic
1163136043 19:15312069-15312091 GCGTGTGCATGTAGGCAAATGGG + Intronic
1163778265 19:19230915-19230937 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1164415425 19:28043288-28043310 GTGTGTGTGTGTGTGGAGACAGG + Intergenic
1164611479 19:29635343-29635365 GTGTGTGTCTGTGGGTGAATAGG - Intergenic
1165251589 19:34541007-34541029 GTGTGTGTATGTGGTGCACAGGG - Intergenic
1165267154 19:34669708-34669730 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
1165439998 19:35820051-35820073 GTGTGTGTGTGTGTGTACATTGG - Intergenic
1165702102 19:37946302-37946324 TTGTGTGTGTGTGTGGAGATGGG + Intronic
1165870185 19:38966307-38966329 GTGTGTGTGTGTGTGGAGATGGG + Intronic
1165897128 19:39149033-39149055 TTGGGAGGATGTGGGGAAATTGG + Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1165996072 19:39845113-39845135 GTGTGTTTGTGTGGAGAGATGGG - Intronic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166536182 19:43576322-43576344 GTGTGTGTGTGTGTGGCAAGGGG - Intronic
1166655189 19:44606050-44606072 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1166689847 19:44815831-44815853 GTGTGTGTGTGTGTGCAAATGGG - Intronic
1166830830 19:45638828-45638850 GTGTGGGTGAGTGGGGAGATGGG - Exonic
1166897243 19:46031776-46031798 GTGTGTGTGTGTGTGCACATAGG + Intergenic
1167230408 19:48279490-48279512 GTGTGTGTGGGTGGGGGGATGGG + Intronic
1167256068 19:48429727-48429749 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1167381647 19:49141945-49141967 GTGTGTGTATGTGTGCTGATGGG + Intronic
1167996221 19:53404631-53404653 GTGTGTGTTTGTGTAGAAATGGG + Intronic
1168477568 19:56687921-56687943 GTGTGTGGATGTGTGGTCATGGG + Intergenic
1168509573 19:56963610-56963632 GTGTATGTCTGTGGGGAGGTGGG - Intergenic
925149378 2:1604246-1604268 GTGTGTGTCTGTGTGTATATTGG - Intergenic
925237235 2:2290621-2290643 GTGTGTGTATGTGTGGACTGGGG - Intronic
925363389 2:3295086-3295108 GAGGGTGTATGTGTGGAAAGAGG - Intronic
925851250 2:8084309-8084331 GTGTGTGTGTGTGTTGGAATTGG - Intergenic
925880909 2:8351565-8351587 GTGTGTGTGTGTGTGTATATAGG - Intergenic
925969252 2:9095655-9095677 GTGTGTGTATGTGGAGGACCCGG - Intergenic
926146691 2:10400758-10400780 GTGTGTGTATGTGTGCATGTGGG - Intronic
926368207 2:12153091-12153113 CTGTGTGTGTTTGGGGATATGGG - Intergenic
926930091 2:18028893-18028915 GGGTGTGTGGGTGGGGAAAGGGG - Intronic
927049846 2:19316646-19316668 TTGTGTGGATGTGGTGAAAAGGG - Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927325509 2:21800751-21800773 GTGTGTGTGTGTGTGCAGATAGG + Intergenic
927404132 2:22748390-22748412 GTGAGTAAATGTGAGGAAATGGG + Intergenic
927416184 2:22883082-22883104 GTGTGTCTGTGTGTGTAAATGGG - Intergenic
927758248 2:25726023-25726045 GTGTGTGTGTGTGTGGAGATGGG + Intergenic
927799915 2:26088942-26088964 GTGTTTGCATGTGGGTATATAGG + Intronic
927831701 2:26356949-26356971 GTGTGTGTGTGTGTGGAGGTAGG - Intronic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
927997972 2:27499603-27499625 TTGTGTGAATGTGGGAAGATGGG + Intronic
928180705 2:29066428-29066450 GCCTGTGCATGTGGGGAACTAGG - Intronic
928291622 2:30043300-30043322 GTGTGTGTGGGTGGGTAGATGGG + Intergenic
928452622 2:31389923-31389945 GTGCGTGTATGTTGGGATAGGGG - Intronic
928608350 2:32965254-32965276 TTGTGTGTATGTGGGGTCAAAGG - Intronic
928879857 2:36086251-36086273 GTGTGTGTGTGTGGAATAATAGG - Intergenic
928923676 2:36553958-36553980 GTGTGGGAAGGTGGGGAAGTCGG - Intronic
929829110 2:45333302-45333324 GTGTGTGTCTGTGGGGGATTGGG - Intergenic
929841659 2:45472116-45472138 GTGTGTGTATGTGTGGGTGTGGG - Intronic
929904793 2:46036404-46036426 TTTTGTGTGTGTGTGGAAATAGG - Intronic
930003647 2:46879372-46879394 GTGTGTGGATGTGGGAATAGCGG - Intergenic
930307383 2:49692485-49692507 GTGTGAGGCTGTGGAGAAATAGG - Intergenic
930896993 2:56458135-56458157 GTGTGTGTGTGTGTGGAGAGAGG - Intergenic
930965794 2:57324379-57324401 GTGTGTGTGTGTGTGTATATAGG - Intergenic
930967219 2:57344289-57344311 GTGTGTGTGTGTGTTGAGATGGG + Intergenic
931051866 2:58424836-58424858 GTGTGTGTATGTGTGTGTATCGG + Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931234612 2:60402697-60402719 GTGTGTGTATGTGGAGCAGGGGG - Intergenic
931256667 2:60580193-60580215 GTGTGTGTGTGTGTGGATAGAGG - Intergenic
931555620 2:63500467-63500489 GTGTGTGTGTGTGTGTAAAGTGG + Intronic
931797742 2:65727927-65727949 GTGTGTGTGTGTGGGGGCAGGGG + Intergenic
931955502 2:67419401-67419423 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
931969445 2:67569365-67569387 GTGTGTGTGTGTTGGGGAATGGG + Intergenic
932067461 2:68580821-68580843 GTGTGTGCATGTGGGGGAGGGGG + Intronic
932156537 2:69423172-69423194 GTGTGTGTGTGTGGTGAGATGGG + Intronic
932332449 2:70905476-70905498 GTGTGTGTTTGTGGGGGTAAGGG - Intronic
932392604 2:71410380-71410402 GTGTGTGTGTGTGTGTAGATGGG + Intronic
932417786 2:71584172-71584194 GTGTGTGTGTGTGTGTGAATGGG + Intronic
932558351 2:72845316-72845338 TGGTGTGGATGTGGAGAAATTGG + Intergenic
932626006 2:73296259-73296281 GTGTGTGTATGTGTGTCCATTGG - Intergenic
932697441 2:73968573-73968595 GTGTGTGTGTGTGGGGGGGTAGG - Intergenic
932721863 2:74144521-74144543 GTGTGTGTGTGTGTGGATAAAGG + Intronic
932827705 2:74956966-74956988 GTGTGTGTGTGTGTAGAAATGGG + Intergenic
932911024 2:75806032-75806054 TTGAGAGGATGTGGGGAAATAGG + Intergenic
932947259 2:76249769-76249791 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
933160241 2:79015711-79015733 TTGTATGTATGTGGGGATTTTGG - Intergenic
933229836 2:79793861-79793883 GTGTGTGTGTGTGTGGTATTGGG - Intronic
933417981 2:82011512-82011534 GTGTGTGTGTGTGAGGCACTAGG + Intergenic
933493962 2:83024479-83024501 GTTTGCGTATGGGGGGAAATGGG + Intergenic
933618942 2:84514852-84514874 GTGTGTGACTGTGGTGAAGTGGG - Intergenic
933762788 2:85684735-85684757 GTGTGTGTGTGTAGTGGAATGGG + Intergenic
933829119 2:86192225-86192247 GTGTGTGTGTGTGTAGAGATAGG - Intronic
934048741 2:88192457-88192479 GTGTGTGTATGTGTGGCAGTGGG - Intergenic
934086854 2:88517093-88517115 GTGTGTGTGTGTGTGGTCATAGG - Intergenic
934578445 2:95418260-95418282 GTGTGTGTGTGTAAGGAAAGAGG + Intergenic
934897209 2:98129247-98129269 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
935423024 2:102890065-102890087 GTGTGTGTATGTGTGTATGTAGG + Intergenic
935620247 2:105123668-105123690 GTGTGTGTGTGTGGAGAGACTGG - Intergenic
935965178 2:108465825-108465847 TTGCGTGGATGTGGGGAAAAGGG - Intronic
936012750 2:108935639-108935661 GTGTGTGTGTGTGTGAAAAGGGG - Intronic
936146248 2:109982153-109982175 GTGTGTGCATGTGTGGCCATGGG - Intergenic
936198443 2:110389326-110389348 GTGTGTGCATGTGTGGCCATGGG + Intergenic
936225722 2:110648634-110648656 GTGTGTATATATGGGGAGGTAGG + Intronic
936231066 2:110699948-110699970 GCGTGTGTGTGAGGGGAATTGGG + Intergenic
936235711 2:110740852-110740874 GTGTTTGAATGTTGGGACATGGG + Intronic
936473859 2:112823058-112823080 GTGTGTGTGTGTGTGGAGACAGG + Intergenic
936545654 2:113390836-113390858 GTGTGTGTTTGTATGGAACTAGG + Intergenic
936628219 2:114171880-114171902 GTGTGTGTGTGTGTGTTAATGGG + Intergenic
937178838 2:119970434-119970456 GAGAGGGTATGAGGGGAAATGGG - Intronic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
937398477 2:121560360-121560382 GTGTTTGTATGCTGGGGAATAGG + Intronic
937551721 2:123101204-123101226 GTGTGTGTGTGTGTAGAAAATGG - Intergenic
937766110 2:125662334-125662356 GTGTGTGTATGTGTGTGTATAGG - Intergenic
937961371 2:127462566-127462588 GTGTGAGGATGTGGAGAAATGGG + Intronic
938012198 2:127837814-127837836 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
938506206 2:131886437-131886459 GTGTGTGTTGGAGGGGAAAGAGG + Intergenic
938852814 2:135278933-135278955 GTGTGTGAGAGTGGGGCAATAGG + Intronic
939721503 2:145658523-145658545 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
939917973 2:148071316-148071338 GTGTGTGTATGTGTAGATATGGG + Intronic
940205242 2:151195250-151195272 GTGTGTGTGTGTGTGGTATTGGG + Intergenic
940365102 2:152839562-152839584 TTGTGTGGATGTGGGGAAAAGGG - Intergenic
940510105 2:154602899-154602921 GTGTACATATGTGTGGAAATTGG - Intergenic
941091196 2:161178023-161178045 TGGTGTGGATGTGGAGAAATTGG + Intronic
941467111 2:165841130-165841152 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
941580272 2:167288528-167288550 GTGTGTGTGTGTCGGGGAAGGGG - Intergenic
942271518 2:174280423-174280445 GTGTGTGTGTGTGTGAAGATGGG + Intergenic
942531528 2:176915315-176915337 GTGTGTGTATGTGTGTATTTTGG - Intergenic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
942733098 2:179080860-179080882 TTGAGAGGATGTGGGGAAATAGG + Intergenic
943199236 2:184798040-184798062 GTGTGTGTGTGTGTGAAGATAGG + Intronic
943295029 2:186127482-186127504 GTGTGTGTGTGTGTGTATATAGG - Intergenic
943372453 2:187031711-187031733 GTGTATGTGTGTGGGGAGTTGGG + Intergenic
943681408 2:190771963-190771985 TTGTGAGAATGTGGTGAAATTGG - Intergenic
943750893 2:191508453-191508475 GTGTGTGTTTGTGGAGAAAGAGG + Intergenic
943872847 2:193024081-193024103 ATGTGAGTATGTGTGGAAAAGGG - Intergenic
943895465 2:193352598-193352620 GTTTGTGTGTGTGTGTAAATTGG - Intergenic
944193079 2:197024021-197024043 CTGTGAGTATGTGGGGAGACAGG + Intronic
944273595 2:197809828-197809850 GTGTGTGTGTGTGTTTAAATAGG + Intronic
944603445 2:201327668-201327690 TGGTGTGGATGTGGGGAAAAGGG + Intronic
944726020 2:202471926-202471948 GTGTGTGTGTGTGTAGAAAGAGG + Intronic
944905403 2:204257036-204257058 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
944949916 2:204736911-204736933 TGGTGTGGATGTGGGGAAAAGGG - Intronic
945423555 2:209669998-209670020 CTTTGTAGATGTGGGGAAATTGG - Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
945675903 2:212855382-212855404 TTGTGTGTGTGTGTGGAAAGAGG - Intergenic
945812660 2:214567533-214567555 GTGTGTGTATGTGGATGAAGGGG - Intronic
945877358 2:215292450-215292472 GTGTGTGTGTTGGGGGAATTTGG - Intergenic
946092625 2:217243499-217243521 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
946155185 2:217802446-217802468 GTGTGAGCATGCGGGGACATGGG - Exonic
946165050 2:217858665-217858687 GTGTGTGTGTGTGTGTACATGGG - Intronic
946521632 2:220471111-220471133 GTGTGTGTATGTGTGTATAATGG + Intergenic
946606325 2:221409230-221409252 GTGTTTGTATGTATGCAAATGGG - Intergenic
946707932 2:222477287-222477309 GTGTGTATATGTGTGTATATAGG + Intronic
946735088 2:222745876-222745898 GTGTGTGTGTGTGGGGAGGGGGG - Intergenic
946854593 2:223940361-223940383 GTGTATGTGTGTGTGTAAATTGG - Intronic
946904971 2:224407148-224407170 GTGTGTGTGTGTTGGGAGAAGGG - Intergenic
947131476 2:226930997-226931019 TAGTGTGAATGTGGGGAAAAGGG + Intronic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
947432704 2:230044748-230044770 GTGTGTGTGTGTGTGTAGATGGG + Intronic
947492788 2:230610421-230610443 GTGTGTGTGTGTGTGTAAATGGG + Intergenic
947771974 2:232677199-232677221 GTGTGTGTGTGTGTAGAGATGGG - Intronic
947784888 2:232808016-232808038 GAGTGTGTAGGTGAGGAAAGTGG + Intronic
947821637 2:233075603-233075625 GTGTGTGTGTGTGTGTATATAGG + Intronic
947962863 2:234254247-234254269 GTGTGTGTGTGTGCGCACATGGG - Intergenic
947991843 2:234495018-234495040 GTGTGTGTGTGTGTGGATATAGG - Exonic
948265363 2:236631993-236632015 GTGTGTGTGAGCGGGGAAAGGGG + Intergenic
948300517 2:236903333-236903355 GTGTGTGTGTGTAGGGAGATGGG + Intergenic
948569376 2:238907781-238907803 GTGTGTTTATGTGTGTAAGTGGG - Intronic
948571977 2:238923338-238923360 GTGTGTGTGTTTGTAGAAATGGG - Intergenic
948585755 2:239018737-239018759 GTGTGTGTGTGTGAGTATATGGG - Intergenic
948716467 2:239867803-239867825 GTGTGTGTATGTGGTGTATGTGG - Intergenic
948813787 2:240499520-240499542 GTGGGTGCATGTGGGGAGCTGGG + Intronic
949076808 2:242064574-242064596 GTGTGTGTATGGGTGAATATGGG - Intergenic
1168848664 20:961792-961814 GAGTGTGTAGGTGGGTAAATAGG - Intronic
1168961252 20:1871496-1871518 GTGTGTGTGTGTGTGGAGAGGGG - Intergenic
1169052169 20:2589310-2589332 GTGTGTGTGTGTGTGGAGATGGG + Intronic
1169110224 20:3027893-3027915 GTGTGTGTAAATGGGGACGTTGG + Intronic
1169713813 20:8593363-8593385 GTGTGTGTATGTGTGAAGACAGG + Intronic
1169831887 20:9834575-9834597 GTGTGCTTATCTGGGGAAAAAGG - Intronic
1169973060 20:11291689-11291711 TTGTGTGTATGTGTAGAGATAGG - Intergenic
1170115065 20:12849072-12849094 ATGTGTGTATGTGGGGAGTGGGG - Intergenic
1170238309 20:14133002-14133024 GTGTGTGTGTGTGTGTATATGGG + Intronic
1170293099 20:14793183-14793205 GTGTGTGTGTGTGTGTAAAGTGG + Intronic
1170298274 20:14853187-14853209 GTGTGTGTGTGTGTATAAATGGG + Intronic
1170428631 20:16258646-16258668 GGGTGTGTGTGTGTGGAATTAGG - Intergenic
1170530579 20:17287451-17287473 GTGTGTGTGTGTGTTAAAATGGG + Intronic
1170881964 20:20304737-20304759 GTGTGGAGAAGTGGGGAAATGGG + Intronic
1170934602 20:20798749-20798771 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1171093843 20:22312484-22312506 GTGTGTGTATGTGGGGGGGGGGG - Intergenic
1171176600 20:23054952-23054974 TTGTGTGTGTGTGCAGAAATGGG + Intergenic
1171214720 20:23344056-23344078 TGGTGAGAATGTGGGGAAATTGG - Intergenic
1171401508 20:24875503-24875525 GTGTGTGTCTGTGGGGATAGAGG - Intergenic
1172032225 20:31990200-31990222 GTGTGTGTGTGTGTGGAAACAGG + Intronic
1172237278 20:33386483-33386505 GTGTGTATATGTGTGTATATAGG + Intronic
1172382511 20:34507216-34507238 ATGTGAGGATGTGGAGAAATTGG - Intronic
1172482446 20:35278788-35278810 GTGTGTGGAGGTGGTGAACTGGG + Intergenic
1172959195 20:38785810-38785832 GTGTGTGTGTGTGTGCAGATAGG + Intergenic
1173005434 20:39136501-39136523 GTGTATGTATGTGGGCAAGGGGG + Intergenic
1173095858 20:40027570-40027592 GTGTGTGTGTGTAGGGAGACTGG + Intergenic
1173160245 20:40646985-40647007 ATGTGTGTGTGTGTGGATATGGG - Intergenic
1173313872 20:41925775-41925797 GTGTGTGTATGTGGCCAAGTAGG + Intergenic
1173418952 20:42883697-42883719 GTGTGTGTATGGGGGTGTATGGG - Intronic
1173418985 20:42883883-42883905 GTGTGTGTATGGGGGTGTATTGG - Intronic
1173418993 20:42883948-42883970 GTGTGTGTATGGGGGTGTATGGG - Intronic
1173485561 20:43438559-43438581 GGGTGTGTGTGTGGGGGGATGGG - Intergenic
1173491115 20:43482728-43482750 GTGTGTGTGTGTGTGTATATAGG - Intergenic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1173675933 20:44835777-44835799 GTGTGTGTATGTGGGGGGTGGGG - Intergenic
1173880861 20:46411224-46411246 GTGTGTGTGTGTGTGTAATTGGG + Intronic
1174063436 20:47847929-47847951 GTGTGTGTGTGTGGTGAGCTTGG - Intergenic
1174072271 20:47907728-47907750 GTGTGTGTATGTGGTGAGCTTGG + Intergenic
1174151789 20:48490972-48490994 GTGTGTGTATGTGGTGAGCTTGG - Intergenic
1174175370 20:48641103-48641125 GGGTGGGTAGGTGGGTAAATGGG + Intronic
1174358691 20:50014944-50014966 GTGGGTGTATTTGGGGACGTGGG + Intergenic
1174494362 20:50929937-50929959 GTGTGTGTGTGTGGCTAAAAAGG + Intronic
1174500296 20:50979355-50979377 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1174736435 20:52970262-52970284 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
1174878551 20:54252061-54252083 GTGTGTGTTGGTGGGGGGATGGG - Intergenic
1174924679 20:54745878-54745900 TGGTGAGGATGTGGGGAAATTGG + Intergenic
1175003936 20:55662238-55662260 GTGTGTGTTTGTAGGGAATGGGG - Intergenic
1175097269 20:56551580-56551602 GTGTGTGTATGTGGTGAGCAGGG + Intergenic
1175104509 20:56604976-56604998 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1175302094 20:57950065-57950087 ATGTGAGAATGTGGAGAAATGGG + Intergenic
1175605488 20:60308861-60308883 GTGTGTGTGTGTAGAGAAAGAGG - Intergenic
1175875898 20:62229370-62229392 GTGTGAGTGTGTGGGGAATGGGG - Intergenic
1175875985 20:62230139-62230161 GAGTGTGTGTGTGTGGAATTGGG - Intergenic
1176242777 20:64082807-64082829 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1176956530 21:15110566-15110588 CTGTTTGCATGTGGGAAAATGGG + Intergenic
1177322976 21:19546005-19546027 GTGTGTGTGTGTGGAGACAGGGG + Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1177533550 21:22396199-22396221 GCGTGTGTATGTGGGCACGTGGG - Intergenic
1177883124 21:26717792-26717814 GTGTGTGTAGGTGGGGTAAGGGG + Intergenic
1177986025 21:27975942-27975964 GTGTGTGTTGGAGGGGAAAGAGG - Intergenic
1178138375 21:29654130-29654152 GAGTGTGTAGGTGGGGAGGTGGG + Intronic
1178153970 21:29830298-29830320 GTGTGTGTGTGTGGGGAGGTGGG - Intronic
1178254287 21:31037328-31037350 GTGTGTGTATAAGAGGAAATGGG + Intergenic
1178356978 21:31917681-31917703 GTGTGTGTATGTTTGGGAATGGG - Intronic
1178398380 21:32262548-32262570 CTGTGTGGATCTGAGGAAATGGG - Intergenic
1178548523 21:33514874-33514896 TTGTGTGGAAGTGAGGAAATCGG - Intronic
1178747745 21:35269492-35269514 GGGTGTGCATGTGAGGAAAGGGG + Intronic
1178811694 21:35888585-35888607 GTGTGCCTATGTGAGGAAAGGGG - Intronic
1178956526 21:37027802-37027824 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1179118528 21:38519980-38520002 GTGTGTGTGTGTGGTGACATGGG - Intronic
1179291041 21:40018392-40018414 GTTTGTATATTTGAGGAAATGGG + Intronic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179522674 21:41955255-41955277 GTGTGTGTATGTGTGGTACATGG + Intergenic
1179743074 21:43428316-43428338 GTGTGTGTGTGTGTGGCGATTGG - Intergenic
1180462926 22:15583229-15583251 GTGTGTGTCTGTGTGTAAGTGGG + Intergenic
1180663659 22:17491571-17491593 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1181087158 22:20446255-20446277 ATATGTGTATGGGGGGAAAAGGG + Intronic
1181153456 22:20901812-20901834 GTGTGTGTGTGTGTGGAGACAGG - Intergenic
1181515729 22:23410788-23410810 GTGTGTGTAGGTGGAGAGAATGG + Intergenic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1182297924 22:29320679-29320701 GTGTGTATACGTGGGTAAACAGG + Intergenic
1182535282 22:30997232-30997254 GTGTGTGTATGTGGTCTATTTGG + Intergenic
1183114906 22:35684248-35684270 TTGTGTGTATGTGGGCTAAAAGG + Intergenic
1183369863 22:37426475-37426497 GTGCGTGTGTGTGTGGACATGGG - Intronic
1183768799 22:39905194-39905216 GTGAGAGTTTGTTGGGAAATAGG - Intronic
1184479944 22:44740494-44740516 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1184961806 22:47934930-47934952 GTGTGTGTGCGTGTGGAGATGGG - Intergenic
1184964136 22:47954994-47955016 GTGTGTGTGTGTGTGGATATAGG - Intergenic
1184975054 22:48055236-48055258 GTGAGTGTATGTGTGAGAATGGG + Intergenic
1185047464 22:48536179-48536201 GTGTGTGTGTGTCGGGGCATGGG - Intronic
949127942 3:469028-469050 GTGTGTGTGTATGGGTGAATTGG + Intergenic
949140274 3:624698-624720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
949465618 3:4340098-4340120 GTGTGTGTGTGTGTGCACATTGG - Intronic
949503565 3:4705030-4705052 GTGTGTGTATGTTTTTAAATGGG + Intronic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
949854354 3:8446938-8446960 TGGTGAGTATGTGGAGAAATTGG - Intergenic
949899546 3:8799004-8799026 GTGTGTGTGTGTGTGGATAGCGG + Intronic
950201496 3:11047855-11047877 GTGTGTGTATTGGGGGTAAGAGG + Intergenic
950636363 3:14317984-14318006 GTGTGTGTTTGTGTGGAGGTCGG + Intergenic
950868138 3:16206204-16206226 GTGTGTGTGCGTGTAGAAATGGG - Intronic
950916766 3:16653970-16653992 GTGTGTGTGTGTGTGGAGAAGGG - Intronic
951129212 3:19022015-19022037 GTGTGTGTATTTGGAGAAGCAGG - Intergenic
951259104 3:20485368-20485390 GAGTGTGTATGTGGGGAGAGGGG + Intergenic
951717522 3:25664807-25664829 GTGTGTGTGTGTGAGGAAATCGG - Intronic
951878885 3:27461201-27461223 GTGTGTGTGTGTGTGCTAATTGG - Intronic
951880389 3:27475657-27475679 CTGTTTGTATCTGGGGAAGTTGG - Intronic
952103806 3:30046089-30046111 GTAGGTTTGTGTGGGGAAATAGG - Intergenic
952179172 3:30899843-30899865 GTGTGTGTGTGTGTGAATATGGG + Intergenic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952492262 3:33884037-33884059 TTGTGTGTATGTGTGGGAAGGGG + Intergenic
952610192 3:35199387-35199409 GAGTGTGTGTGTGTGGAAGTTGG + Intergenic
952660141 3:35835811-35835833 GTGTGCATATGTGTGCAAATAGG + Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
952772794 3:37017560-37017582 GTGTGTGTTTTTGGGCAAATAGG - Exonic
953080699 3:39614624-39614646 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
953139814 3:40218158-40218180 GTGTCTGTGTGTGTGGACATAGG - Intronic
953474715 3:43195515-43195537 GTGTGTGTACTGGGGGAGATTGG - Intergenic
953624330 3:44558183-44558205 GTGTGTGTGTGTGTGGGCATGGG + Intronic
953749277 3:45596780-45596802 GTGTGTGTCTGTGTGTAGATGGG + Intronic
954245640 3:49329396-49329418 GTGTGTGTGTGTGGGCAGGTGGG + Intronic
954430939 3:50470575-50470597 GTGTGTGTATATGGGGGGAGGGG + Intronic
954521637 3:51232508-51232530 GGGTGTGGATGTGGTGAAAAGGG - Intronic
954555513 3:51514687-51514709 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
954601677 3:51875265-51875287 CAGAGTGTATGGGGGGAAATAGG + Intronic
954662911 3:52235535-52235557 GTGTGTGTGTGTGTGTGAATGGG - Intronic
954728120 3:52633643-52633665 TGGTGTGTATGTGGAGAAATTGG - Intronic
954781956 3:53068327-53068349 GTGAGTGTATGTGGGTACCTTGG - Intronic
954795055 3:53157129-53157151 ATGTGTGTAGGTGGGGAGAAGGG - Intronic
954916019 3:54149260-54149282 GTGTGTGTGTGTGTGCACATGGG - Intronic
954957406 3:54533813-54533835 GTGTGTGTGTGTGTGTTAATAGG + Intronic
955111515 3:55955274-55955296 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
955326090 3:58010114-58010136 GTGTGTGTATGTGGGTGGGTGGG + Intronic
955603294 3:60671344-60671366 GTGTGTGTATGTGTGTATTTTGG - Intronic
955780505 3:62479178-62479200 CTGTGTGCAGTTGGGGAAATTGG + Intronic
955937029 3:64111993-64112015 GTGTGTGTGTGTTGGGATAGGGG - Intronic
956042532 3:65159625-65159647 TTGTGAGGATGTGGAGAAATTGG - Intergenic
956369185 3:68539669-68539691 GTGTGTGTGTGGGGGGGCATGGG + Intronic
956508534 3:69969296-69969318 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
956510805 3:69991299-69991321 TTGTGTCTATGTGGGGGCATTGG - Intergenic
956534846 3:70264803-70264825 GGGTGTGTGTGTAGGGACATCGG + Intergenic
956728546 3:72176785-72176807 GGGTGTGTCTGTGGGGAACTGGG + Intergenic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
956900354 3:73709014-73709036 GTGTGTGTATGTGTGGATCAAGG + Intergenic
956933796 3:74076636-74076658 GTGTGTGTGTGTGGTGAGGTTGG - Intergenic
957181334 3:76882022-76882044 GTGTGTGTATGTGGGTGGCTGGG + Intronic
957437933 3:80203133-80203155 GTGTGTGTGTGTGGGTGAGTGGG - Intergenic
957454713 3:80426662-80426684 TTTTGTGTATGTTGGGAAAGAGG + Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
957614661 3:82510977-82510999 GTGTGTGTATGTGTATAAAAAGG - Intergenic
957715012 3:83916922-83916944 GTGTGTGTATGTGTGTGTATAGG + Intergenic
958032541 3:88130250-88130272 GTGTGTGTATGTGTGTATATGGG - Intronic
958772555 3:98443371-98443393 TTTTGTGTATGTTGTGAAATAGG + Intergenic
958804741 3:98796229-98796251 GTGTGTGTGTGTGTGGCACTGGG - Exonic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
959384151 3:105680883-105680905 GTGTGTGTATATGTTGAAGTTGG - Intronic
959500626 3:107102364-107102386 GTGTGTGTATGTGTTTAGATAGG - Intergenic
959903073 3:111681583-111681605 ATGTGTGTGTGTTGGGTAATGGG - Intronic
959948831 3:112155473-112155495 CTGTGTGTATGTTGGGCTATTGG + Intronic
959987246 3:112588103-112588125 GTGTTAGTATGTGGTGAACTTGG + Intergenic
960050466 3:113234351-113234373 GTGTGTGTATGTGTGCACATGGG + Intronic
960401295 3:117202290-117202312 GTGTGTGTGTGTGGAGAGAGAGG - Intergenic
960533483 3:118791552-118791574 GTGTGTGTGTGTGTTGAAATGGG - Intergenic
960589584 3:119352603-119352625 GTGTGTGTGTGTGTGGGAAGAGG - Intronic
960630347 3:119724302-119724324 TTGTGTTTACTTGGGGAAATGGG + Intronic
960708624 3:120505524-120505546 GTGTGTGTGTGTGGTGGAAGGGG - Intergenic
960959432 3:123059078-123059100 GTGTGTGTATGTTGGGATATGGG + Intergenic
961222037 3:125208741-125208763 GTGTGTGTGTGTGTGTAGATTGG - Intronic
961474685 3:127139272-127139294 GTGTGTGTGTGTGTGGATAGAGG + Intergenic
961661210 3:128469767-128469789 GGGTGTGTGTATGGGGAGATGGG - Intergenic
961937435 3:130600223-130600245 TTGTGAGGATGTGGAGAAATAGG + Intronic
961966823 3:130913621-130913643 GTGTGTGTATGGGGGAAGAGGGG + Intronic
961993094 3:131213184-131213206 GTGTGTGTGTGTGTGGAGATGGG - Intronic
962329748 3:134467118-134467140 TGGTGAGGATGTGGGGAAATGGG - Intergenic
962388134 3:134949405-134949427 GTGTGGAGAGGTGGGGAAATGGG - Intronic
962422008 3:135237269-135237291 GTGTGTGTGTGTGTAGAATTTGG - Intronic
962445562 3:135460883-135460905 ATGTGTGTGTGTGTGTAAATGGG + Intergenic
962580587 3:136794412-136794434 GTATATGTATTTGGGGAAGTGGG - Intergenic
962670382 3:137699988-137700010 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
962733724 3:138305524-138305546 GTGTGTGTGTGTTGGGGAATAGG - Intronic
962830795 3:139137781-139137803 GTGTGTGTATGTGGGGTGCACGG - Intronic
963428488 3:145163577-145163599 GTGTGTGTGTGTTGGCAATTAGG - Intergenic
963783113 3:149507116-149507138 GTGTGTGTGTGTGTAGACATAGG - Intergenic
964046166 3:152330033-152330055 GTGTGTGTATGTGTGTTTATTGG + Intronic
964085925 3:152818164-152818186 TTGTGTGTATGTGGGGGACAGGG - Intergenic
964171587 3:153776585-153776607 TTGTGAGGATGTGGGGAAACTGG - Intergenic
964171902 3:153780763-153780785 GTGTGTGTGTGTGTACAAATTGG + Intergenic
965032318 3:163388018-163388040 GAGTGGGGAGGTGGGGAAATGGG + Intergenic
965162083 3:165146616-165146638 TGGTGTGGATGTGGAGAAATGGG - Intergenic
965343620 3:167520085-167520107 GTGTGTGTGTGTGTGCAAACTGG + Intronic
965347768 3:167573209-167573231 GTGTGTGTCTGTGGGGGTGTAGG - Intronic
965459574 3:168945466-168945488 GTATGTGGTTGGGGGGAAATGGG + Intergenic
965491818 3:169346755-169346777 GTGTGTAAGAGTGGGGAAATAGG + Intronic
965565751 3:170115868-170115890 GTGTGTGTGTGTGAGAAACTTGG - Intronic
965598522 3:170432438-170432460 GTGTGTGTATGTGGAGTGAGTGG + Intronic
965652931 3:170952701-170952723 GTGTGTGTATGTGTGTATAGAGG + Intergenic
965933830 3:174080943-174080965 GTGTGTGTGTGTGTGGTGATAGG + Intronic
965933832 3:174080945-174080967 GTGTGTGTGTGTGGTGATAGGGG + Intronic
966081394 3:176006931-176006953 GTGTCTGTGTGTGTGGAAAAAGG - Intergenic
966305567 3:178530214-178530236 CTGTGTGCATGTGGTCAAATGGG - Intronic
966465079 3:180222507-180222529 GTGTGTGTGTGTGTTTAAATAGG - Intergenic
966695006 3:182780417-182780439 GGCTGTTTATGTGGGGACATAGG + Intergenic
966896993 3:184452621-184452643 GTGTGTGTGTGTGTGGAGATGGG - Intronic
967087199 3:186106776-186106798 GTGTGTGAGTCTGGGGAAAAAGG + Intronic
967437917 3:189472171-189472193 GGGTGAGGATGTGGAGAAATTGG - Intergenic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
967592610 3:191296240-191296262 GTGTGTGTAAGTTGGGGAAGGGG - Intronic
967598042 3:191350986-191351008 ATGTGTGTATGTGGGGGATGTGG + Intronic
967665065 3:192161499-192161521 GTGTGTGTGTGTGTGTAAATAGG - Intronic
967744552 3:193040555-193040577 GGGTGTGTGTGTGGTGGAATAGG + Intergenic
967974321 3:195024112-195024134 GTGTGTGTAGATGGGGGAGTTGG - Intergenic
968065372 3:195755885-195755907 GTGTGTGTAAGTGGTGAAGGAGG + Intronic
968065536 3:195757036-195757058 GTGTGTCTGTGTTGGGAGATGGG - Intronic
968120479 3:196122472-196122494 GTCTGAGTTTGTGGGGAAACGGG + Intergenic
968430430 4:555278-555300 GTGTGTGCATGTGTGTAGATGGG - Intergenic
968430463 4:555456-555478 GTGTGTGGATGTGTGTAGATAGG - Intergenic
968430491 4:555630-555652 GTGTGTGGATGTGTGTAGATAGG - Intergenic
968490411 4:887940-887962 ATGTGTGCATGTGAGGGAATGGG - Intronic
968522939 4:1042406-1042428 GTGGGTGTAGGTGTGGAAGTGGG - Intergenic
968673648 4:1865421-1865443 GTGTGTGTGTGTGGGGGGATTGG + Intergenic
968765527 4:2466649-2466671 GTGTGTGTGTGTGTGGAGAGGGG + Intronic
968788824 4:2645046-2645068 GTGTGTGTGTGTGTGTGAATGGG + Intronic
969121117 4:4912037-4912059 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
969147347 4:5135787-5135809 TTTTGTGTATGTGAGGAAAGGGG - Intronic
969681434 4:8645467-8645489 GTGTGTGGGTGTGGGGACATGGG + Intergenic
969747574 4:9086024-9086046 TGGAGAGTATGTGGGGAAATAGG + Intergenic
969908168 4:10416997-10417019 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
969952964 4:10857528-10857550 GTATGTGTATGTGTGTAAATTGG - Intergenic
970143051 4:13003507-13003529 GTGTGTGTGTGTGGGGGGAGGGG + Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970297107 4:14641869-14641891 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
970686739 4:18577118-18577140 GTGTGTGTGTGTGTGTAAAGGGG + Intergenic
970687673 4:18587028-18587050 GGATGTGTAAGTGTGGAAATAGG + Intergenic
971494085 4:27245847-27245869 GTGTGTGTGTGTAGGGACAGAGG + Intergenic
971551516 4:27963866-27963888 GTGTGTGTGTGTGTGCACATTGG + Intergenic
971761903 4:30776871-30776893 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
971816828 4:31501721-31501743 GTGTGTGTGTGTGTGTAAAGGGG - Intergenic
971859074 4:32080721-32080743 GTCTGTGGATGTGGTGAAAATGG - Intergenic
972723928 4:41729180-41729202 GTGTGGGTAAGTGGGGGAAGAGG - Intergenic
973139602 4:46750187-46750209 GTGTGTGTGTGTGTAGAGATGGG - Intronic
973558905 4:52114205-52114227 GTGTATAAATGTGGGGAACTGGG + Intergenic
973994562 4:56444366-56444388 GTGAGTTTCTGTGAGGAAATTGG - Intronic
974032252 4:56786644-56786666 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
974043636 4:56879089-56879111 AAGTGTGTCTGTGGTGAAATGGG + Intergenic
974376587 4:61085614-61085636 GTGTGTGTATGTGTGTGTATGGG + Intergenic
974466671 4:62266027-62266049 GTGTGTGTGTGTGTGGAGAATGG + Intergenic
974466673 4:62266029-62266051 GTGTGTGTGTGTGGAGAATGGGG + Intergenic
974795548 4:66744519-66744541 GTGTGTGTGTGTGTGGAGGTGGG - Intergenic
974921038 4:68239333-68239355 CTGTGTGTATTTTGGGAGATGGG - Intronic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975244223 4:72099897-72099919 TTATGTATATGTGTGGAAATGGG - Intronic
975340598 4:73235418-73235440 TTGGGTGTATGTGGGGAGAGAGG - Intronic
975626607 4:76355817-76355839 GTGTGTGTGTGTGTAGACATGGG + Intronic
975799503 4:78045121-78045143 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
975888100 4:78990134-78990156 GTGTGTGTGTGTGTAGGAATGGG + Intergenic
976231958 4:82853330-82853352 GTGAGTTTATTGGGGGAAATAGG - Intronic
976384852 4:84444979-84445001 TGGTGAGGATGTGGGGAAATTGG - Intergenic
976546163 4:86338095-86338117 GTGTGTGTGGGAGGGGAAGTGGG - Intronic
976770706 4:88649406-88649428 GTGTTTGTATGTGGGGGGAGAGG + Intronic
976949226 4:90809144-90809166 GTGTGTGTGTGTGTGGAAATGGG - Intronic
976997676 4:91455815-91455837 ATGTGTGTATGTGGAGGAATGGG + Intronic
977046498 4:92074097-92074119 GTGTGTGTGTGTGTGGCAGTGGG + Intergenic
977088042 4:92629659-92629681 TAGTGTGTATATGGGAAAATGGG + Intronic
977254488 4:94725815-94725837 GTGTGTGTGTGTGTAGAAATGGG + Intergenic
977284538 4:95085997-95086019 GTGTGTGTGTGTGTGTAAAAAGG + Intronic
977381917 4:96286235-96286257 GTGTGTGTGTGTGTATAAATTGG - Intergenic
977823218 4:101500557-101500579 GTGTGTGTGTGCTGGGATATGGG + Intronic
978619557 4:110624876-110624898 GTGTCTGTATGTGTGGAATGGGG - Intronic
978742913 4:112158960-112158982 ATGTATGTATGGGGGGAAAAGGG - Intronic
978768406 4:112428949-112428971 GTGTGTGTCTGCTGGGAAAAAGG + Intronic
978853134 4:113362361-113362383 GTATGCGTGTGTGGGTAAATAGG - Intronic
979014206 4:115412096-115412118 GTGTGTGTGTGTGTGGAGACAGG + Intergenic
979060074 4:116046252-116046274 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
979176216 4:117667279-117667301 TTGTGAGGATGTGGAGAAATAGG - Intergenic
979790287 4:124772037-124772059 TGGTGTGTATGTGGTGAAAAGGG - Intergenic
979842249 4:125457108-125457130 GTGTGTGTATGAGAGAAACTGGG - Intronic
979871776 4:125832447-125832469 TGGTGTGTATGTGGAGAAAAAGG + Intergenic
980039955 4:127927864-127927886 GTGTGTGTCTGTGAAGAAATAGG + Intronic
980550672 4:134329454-134329476 GTGTGTGTATGTGAGTCCATTGG + Intergenic
980737778 4:136913408-136913430 GTGTGTGTGTGTGGGGGGGTGGG - Intergenic
980737809 4:136913735-136913757 GTGTGTGTCTGTGTGTATATAGG + Intergenic
980747673 4:137040759-137040781 TTGTGTGGATGTGGTGAAAAGGG - Intergenic
980787911 4:137578542-137578564 GTGTGTGTGTGTGTGGCTATTGG - Intergenic
980975769 4:139608995-139609017 GTGTGTGTTTGTGTGTAAAGTGG + Intergenic
981031713 4:140132008-140132030 GAGTGTGTATGTGCGGCAATTGG + Intronic
981554955 4:145983030-145983052 GGGAGTGTGTGTGGGGAAAGGGG - Intergenic
981778277 4:148395134-148395156 GTGTGTGTATGTGTGGAGAGAGG + Intronic
981878778 4:149581913-149581935 GTGTGTGTATGTGAGGAGAAGGG + Intergenic
981887532 4:149694537-149694559 GTGTGTGTGTGTGTGGAAGGAGG - Intergenic
981890785 4:149734150-149734172 GTGTGTGTTGTTGGGGGAATAGG - Intergenic
981942680 4:150301324-150301346 GTGTGTATATGTCGGGGAGTAGG - Intronic
981959997 4:150525436-150525458 GTGTCTGTGTGTGGGAAAATGGG + Intronic
982004737 4:151052841-151052863 GTGTGTGTGTGTGTGAAATTTGG + Intergenic
982076839 4:151746196-151746218 GTGTGTGTATGTGTAAACATGGG + Intronic
982367539 4:154596492-154596514 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
982759709 4:159266640-159266662 GTGTGTGTATGTGTGTGTATGGG + Intronic
982844050 4:160226863-160226885 GTGTGTGTGTGTGGGGGGGTGGG + Intergenic
982984156 4:162183545-162183567 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
983531752 4:168816860-168816882 GTGTGTGTGTGTGTAGAAAAGGG + Intronic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
983882230 4:172946139-172946161 GTGTGTGTGTGTGAAGAAAGAGG + Intronic
983922417 4:173360130-173360152 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
984043408 4:174767117-174767139 GTGTGTGTGTGTGTGTAAAATGG - Intronic
984059047 4:174968760-174968782 GTGTGTGTGTGGGCGGAAAGTGG - Intronic
984148667 4:176097714-176097736 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
984405865 4:179328984-179329006 GTGTGTGTGTGTTGGGATGTGGG - Intergenic
984462528 4:180056550-180056572 GTGCAAGTGTGTGGGGAAATGGG + Intergenic
985315736 4:188657261-188657283 CTGTGTATATGTGGTGAAATGGG - Intergenic
985320501 4:188705867-188705889 GTGTGTGTGTGTGTGGAGACAGG + Intergenic
985636122 5:1036625-1036647 GTGTGTGTATGTGGCGGATGCGG + Intronic
985974946 5:3410888-3410910 GTGTGTGTGTGTAGAGAAAGAGG - Intergenic
986325322 5:6668796-6668818 CTGTGTGTAAGTGGAGAACTTGG + Exonic
986669867 5:10133251-10133273 GTGCGTGTGTGTGGGGACAGAGG - Intergenic
986825618 5:11519000-11519022 GTGTGTGTGTGTGTTGAGATAGG - Intronic
987698015 5:21357081-21357103 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987848023 5:23313299-23313321 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987917668 5:24236432-24236454 GTATGTGTCTGTGTGTAAATGGG + Intergenic
987997350 5:25301802-25301824 GTGTGTGTGTGTAGGAAAAGGGG + Intergenic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988084955 5:26463254-26463276 GTGTGAGTATGTTTGGAGATTGG - Intergenic
988110261 5:26810180-26810202 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
988195630 5:28001891-28001913 TGGAGTGGATGTGGGGAAATAGG - Intergenic
988281201 5:29149518-29149540 GTGTGTGTCTGAGGGGAGAGGGG - Intergenic
988433924 5:31151049-31151071 GTGTGTGTGTGTGTGTAAAAGGG - Intergenic
988541692 5:32115898-32115920 GGGTGTGTTAGTGGGGATATGGG - Intergenic
988700726 5:33671923-33671945 GTGTGTGTATGTGAGTATGTGGG - Intronic
988700730 5:33671994-33672016 GTGTGTGTATGTGAGTATATGGG - Intronic
988700753 5:33672267-33672289 GTGTATGTATGTGGGGGTGTGGG - Intronic
988847829 5:35146938-35146960 ATGTGTGTGTGTGGTGAAGTGGG - Intronic
989153248 5:38320630-38320652 GTGTGTATATGTGTGGTGATGGG + Intronic
989523173 5:42424208-42424230 GTGTGTGTGTGTCTGGAAGTTGG + Intronic
989563147 5:42873863-42873885 GTGTGTGTGTGTGTAAAAATGGG - Intronic
989629380 5:43465321-43465343 GGATGTGGATGTGGAGAAATAGG + Intronic
989755998 5:44955128-44955150 GTGTGTGTATGTGGGAATCTGGG - Intergenic
989992105 5:50779168-50779190 GTGTGTGTATGTGTGGTAGTAGG - Intronic
990061320 5:51652732-51652754 GTGTGTTTGTGTGGAGAAATGGG + Intergenic
990074777 5:51831037-51831059 GTGTGTATCTGGGGGGAGATAGG - Intergenic
990272229 5:54155675-54155697 GTGTGTGTGTGTGTGTGAATGGG - Intronic
990314005 5:54567227-54567249 GTGCGTGTGTGTGTGGAGATGGG + Intergenic
990361249 5:55022308-55022330 GTGTGTGTGGCGGGGGAAATGGG - Intronic
990525692 5:56624679-56624701 GTGTGTGTGTGTGTAGGAATTGG - Intergenic
990577650 5:57138585-57138607 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
990827233 5:59914584-59914606 GTGTGTGTGTTTGGGGGAAGAGG + Intronic
990957789 5:61361058-61361080 GTGTGTGTTTGTGGGGGAGGGGG + Intronic
990998355 5:61756513-61756535 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
991076155 5:62540852-62540874 GTCTCTCTATGGGGGGAAATAGG + Intronic
991163938 5:63539659-63539681 GTGTGTTTCTAGGGGGAAATGGG + Intergenic
991326196 5:65436211-65436233 GTGTGTGTGTGTGTAGAGATGGG - Intronic
991443713 5:66678256-66678278 GGGTGTGTATGGGGGGAATGGGG + Intronic
991742425 5:69695297-69695319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991755269 5:69859911-69859933 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991793999 5:70275037-70275059 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991821815 5:70570600-70570622 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991834596 5:70735059-70735081 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991886376 5:71274569-71274591 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991895129 5:71387813-71387835 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
991990284 5:72331408-72331430 GTGTGTGTTTTTGGTGATATTGG + Intronic
992122635 5:73610441-73610463 CTGTGTGTGTTTGGGGAGATGGG + Intergenic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993133691 5:83930412-83930434 GTGTGTGTGTGTGGAGTATTAGG + Intergenic
993344305 5:86763509-86763531 GTGTGTGTATGGGGTGGAATTGG - Intergenic
993378838 5:87182450-87182472 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
994041847 5:95267827-95267849 GTGTGTGTGTTGGGGGAGATGGG - Intronic
994202140 5:96989027-96989049 GTGTGTATGTGTGTGGAAAGAGG + Intronic
994206859 5:97044996-97045018 GTGTGTGAATGTGGGAAGAGAGG + Intergenic
994261205 5:97660989-97661011 GTGTGTGTGTGTGTGTAGATGGG + Intergenic
994407968 5:99369535-99369557 GTGTGTGTATTTAGGTAAAAGGG + Intergenic
994490868 5:100441691-100441713 GTGTGTATATGTGTGTATATAGG + Intergenic
994629857 5:102271884-102271906 GTGTGTATATGTTGCGAAAAAGG + Intronic
994731256 5:103493956-103493978 TGGTGAGGATGTGGGGAAATTGG - Intergenic
994762332 5:103870898-103870920 GTGTGTGTATGTGTGTGTATAGG - Intergenic
994790543 5:104221150-104221172 ATGTGTGTATGTAGGGAATGGGG + Intergenic
995245046 5:109925485-109925507 GTGTGTGTATGTGGAGGGAATGG + Intergenic
995245718 5:109933001-109933023 GTGTGTGTATGATGGGAATGGGG + Intergenic
995284946 5:110377510-110377532 TTGTGTGTGTTTGGGGAAAACGG - Intronic
995520991 5:113005154-113005176 GTGTGTGTGTGTGTGTAAACTGG + Intronic
995609435 5:113893306-113893328 GTGTGTGTATGGGTGCAAAATGG + Intergenic
995712442 5:115049292-115049314 GTGTGTGTCTGTGGGACATTTGG - Intergenic
996148149 5:120000588-120000610 TTGTGTGTGTGTGGGGAGGTCGG + Intergenic
996230298 5:121055680-121055702 GTGTGTGTGTGTGTGTAAAGGGG + Intergenic
996309486 5:122088477-122088499 ATGAGCGGATGTGGGGAAATTGG - Intergenic
996400649 5:123058558-123058580 TGGTGTGGATGTGGGGAAAGGGG + Intergenic
996568970 5:124911773-124911795 GTGTGTGTGTGTGTTGGAATAGG - Intergenic
996617220 5:125456527-125456549 TTGTGAGGATGTGGAGAAATAGG - Intergenic
996994838 5:129683226-129683248 ATGTGTGTATGTGGGGGAGGGGG + Intronic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
997197792 5:131991202-131991224 GAGTTTGTATGTGGGGACACTGG - Intronic
997202155 5:132017291-132017313 GTGTGTGTATGTGGTGAGGGGGG + Intergenic
997451122 5:133984230-133984252 GTGTGTGCATGTGGGTAGACGGG + Intronic
997451151 5:133984454-133984476 GTGTGTGTGTGTGTGTAGATGGG + Intronic
997758176 5:136420058-136420080 GTGTGTGTGCATGGGGAAGTGGG + Intergenic
998432622 5:142079395-142079417 GTGTGTGTGTGTGGGGCGGTGGG + Intergenic
998897539 5:146815715-146815737 GTGTGTGTGTGTGGAAAAGTGGG - Intronic
998906940 5:146915441-146915463 GTGTGTGTGTGTGTGTACATAGG - Intronic
999022285 5:148180326-148180348 GTGTGAGTATGTGGTGAAAGTGG + Intergenic
999038395 5:148379620-148379642 GGGTGAGGATGTGGAGAAATTGG + Intergenic
999174984 5:149625752-149625774 GTGTGTGTGTGTGGAGAGGTGGG - Intronic
999229868 5:150055383-150055405 GTGTGTGGGTGTGCGGGAATGGG - Intronic
999248627 5:150168313-150168335 CTGGGTGTGTGTGGGGAGATGGG - Intronic
999521468 5:152355042-152355064 GTGTGTGTGTGTGTGTGAATAGG + Intergenic
999651661 5:153774069-153774091 GTGTGTGTGTGTGGGGGGAGGGG - Intronic
999680730 5:154057696-154057718 GTGTGTGTGTGTGTAGAGATGGG + Intronic
999732820 5:154488123-154488145 GTGTGTGTGTGTGTGTAAAGTGG + Intergenic
999814069 5:155158227-155158249 GGATGTGGATGTGGAGAAATAGG - Intergenic
1000136382 5:158356378-158356400 TTGTGTGTGTGTGAGGAAAGAGG - Intergenic
1000373693 5:160560308-160560330 GTGTGTGTGTGTGAGGGAAGGGG + Intergenic
1000460745 5:161514589-161514611 GTGTGTATGTGTGTGTAAATTGG + Intronic
1000603898 5:163307620-163307642 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1000924197 5:167173727-167173749 GTGTGTGTATGTGGGTGTGTAGG + Intergenic
1000949181 5:167459648-167459670 TGGTGTGTATGTGGAGATATTGG - Intronic
1001007727 5:168068719-168068741 GTGTGTGTATGTTGGAGATTGGG - Intronic
1001067443 5:168548029-168548051 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1001351979 5:170977353-170977375 GAGTGAGAATGTGGAGAAATAGG + Intronic
1001408485 5:171493944-171493966 GTGGGTGTATCTGGGATAATGGG - Intergenic
1001462855 5:171933585-171933607 GTGTGTGTATGTGGGTAGAAGGG + Intronic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001738451 5:174027855-174027877 GTGTGTGTTTGTAGGGAAAGGGG + Intergenic
1002484809 5:179527581-179527603 ATGTGTGTCCATGGGGAAATGGG - Intergenic
1002923665 6:1592309-1592331 GTGTGTGTGTGTGTGGAGAGGGG - Intergenic
1003122441 6:3329166-3329188 GTGTGTGTTTGTGGGGGATGAGG - Intronic
1003614226 6:7640849-7640871 GTGTGTGTATGTGTGCCTATGGG + Intergenic
1004110029 6:12708798-12708820 GTGTATGTTTGAGAGGAAATTGG - Intergenic
1004121331 6:12825106-12825128 GTGTGTGTGTGTGTGGAGATGGG - Intronic
1004165219 6:13250994-13251016 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1004469216 6:15914030-15914052 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1004521128 6:16361935-16361957 GTGTGATTATCTGGTGAAATTGG + Intronic
1004612340 6:17255389-17255411 GTGTCTTCATGTGGTGAAATGGG - Intergenic
1004613825 6:17270822-17270844 GTGTGTGTGTGTAAGGAAAGTGG + Intergenic
1004648619 6:17587215-17587237 GTGTGTGTGTGTGTGTATATGGG - Intergenic
1004751818 6:18569358-18569380 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1004830328 6:19470247-19470269 GTGTGTGTGTGTGTGTGAATGGG - Intergenic
1004867425 6:19868104-19868126 GTGTGTGTGTGTGGAGGACTGGG - Intergenic
1004935062 6:20499434-20499456 GTGTGTGTGTGTTCAGAAATGGG + Intergenic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005230414 6:23695132-23695154 GTGTGTGTATATGTGGTGATGGG - Intergenic
1005364136 6:25060501-25060523 TTGTGTGTGTGTGTGGAAAGGGG + Intergenic
1005465926 6:26113236-26113258 GTTTGTATATGTGGTGAAACAGG - Intergenic
1005552834 6:26941297-26941319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1005823049 6:29613522-29613544 GTGTGTGGGTGTGGGGGAAGGGG + Intronic
1005919551 6:30388039-30388061 TTGTGTGGATGTGGTGAAAAGGG + Intergenic
1005952313 6:30641102-30641124 GTGTGTGTATGTGTGTATATGGG - Intronic
1006533186 6:34674889-34674911 GTGTGTATGTGTGTGGAGATGGG - Intronic
1006868928 6:37232655-37232677 GGGAGTGTATATGTGGAAATGGG - Intronic
1007310753 6:40944305-40944327 GTGTGTGTATGTCGGGGGGTGGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007418326 6:41705057-41705079 GAGTGTGTATGTGTGGACAGTGG - Intronic
1007550175 6:42723043-42723065 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1007668668 6:43533207-43533229 GTGTGTGTGTGTGTGTAGATAGG - Intronic
1007809265 6:44474698-44474720 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1007994059 6:46287466-46287488 GTGTGTGTATTTTGGGAAGTGGG - Intronic
1008020125 6:46566887-46566909 GTGTGTGTATGTGTATATATGGG - Intronic
1008098301 6:47363109-47363131 GTGTGTGTGTGTGTGGTAGTGGG - Intergenic
1008255954 6:49299761-49299783 GTGTGTGTATGTGTGTATTTGGG - Intergenic
1008311492 6:49980784-49980806 GTGTGTGTGTGTTGGCAGATAGG - Intergenic
1008321961 6:50125338-50125360 GTGTGTGTGTGTGTGAAGATAGG - Intergenic
1008503296 6:52204907-52204929 GTGAGAGGATGTGGAGAAATAGG - Intergenic
1008551163 6:52632576-52632598 GTGTGTGTGTGTGTAGAGATAGG + Intergenic
1008585732 6:52947269-52947291 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1008869162 6:56251575-56251597 GAGTGTGTATGTGAAAAAATGGG + Intronic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1008920648 6:56841828-56841850 GTGTGTGTATGTGGGTGGGTGGG - Intronic
1008931036 6:56940177-56940199 GTGTGTGTATGGGGGTAATGTGG - Intronic
1009474159 6:64067073-64067095 ATATTTGTATGTGGGGAGATAGG - Intronic
1009514176 6:64593209-64593231 GTATATGTCTGTGTGGAAATGGG + Exonic
1009569129 6:65358628-65358650 GTGTGTGTGTGTTGGGAGAAGGG + Intronic
1009569948 6:65371771-65371793 GTGTGTGTAATGGGGGAAGTGGG + Intronic
1009571761 6:65394236-65394258 GTGTGTGTGTGTGTGCAAAATGG + Intronic
1009730085 6:67590980-67591002 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1009914973 6:69983041-69983063 GTGTATGTAAGTGTGGAAATTGG - Intronic
1010020839 6:71158232-71158254 GTGTGTGTATGTAGGGGGAGGGG + Intergenic
1010101001 6:72108260-72108282 GTGTGTGTATGTGGAGACTGGGG + Intronic
1010116117 6:72314068-72314090 GTGTGTGTATGTGGGTGTAGTGG + Intronic
1010225820 6:73487963-73487985 TGGTGAGTATGTGGAGAAATGGG - Intronic
1010458739 6:76088542-76088564 TTGTGTGGATGTGGTGAAAAGGG - Intergenic
1010674533 6:78726051-78726073 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1010763850 6:79756024-79756046 GTGTGTGTGTGTGTGGAAATGGG + Intergenic
1010840559 6:80644863-80644885 GTGTGTGTGTGTGGGGGTACTGG + Intergenic
1010977029 6:82326784-82326806 GTGTGTGTGTGTGTGTCAATGGG + Intergenic
1011067499 6:83343162-83343184 GTGTGTGTATGTCAGGATAGAGG - Intronic
1011107183 6:83795501-83795523 GTGTGTGTGTGTGTGCAAATAGG + Intergenic
1011384069 6:86775228-86775250 GTGTGTGTGTGTGTGGTGATGGG - Intergenic
1011614915 6:89189060-89189082 GTGTGTGTGTGTTGGGCAAAGGG + Intronic
1011792041 6:90908939-90908961 ATATTTTTATGTGGGGAAATAGG + Intergenic
1012541119 6:100363050-100363072 ATGTGTGTGTGTGGGGAGAGGGG - Intergenic
1012637189 6:101558577-101558599 GTGGGTGTATGGTGGGAATTTGG + Intronic
1012640936 6:101612742-101612764 GTGTGTGTGTGTAGGTACATAGG + Intronic
1012757196 6:103247279-103247301 GTGTGTGATTGTGGAGAAATTGG + Intergenic
1012818763 6:104058249-104058271 GTGTGTGTATGTGTGTAGATGGG - Intergenic
1012961955 6:105631445-105631467 ATGTTTTTAAGTGGGGAAATGGG - Intergenic
1013050982 6:106534817-106534839 GTGTGTGTAGGGGTGGAAGTGGG + Intronic
1013083805 6:106837666-106837688 GTGTGTGTGTGTGTGGAGACAGG + Intergenic
1013285028 6:108673753-108673775 GTGTGTGTATGTGGGGGGCGGGG - Intronic
1013320423 6:108982604-108982626 TGGTGAGGATGTGGGGAAATTGG - Intergenic
1013799260 6:113922105-113922127 GTGTGTGTGTGTTTGTAAATAGG + Intergenic
1013937681 6:115617754-115617776 GTGTATGTATGTGTGGTAAGAGG - Intergenic
1014533673 6:122591185-122591207 GTGTGTGTGTGTCGAGAGATAGG - Intronic
1014705414 6:124740460-124740482 GTGTGTGTGTGTGTGGTGATAGG + Intronic
1014899834 6:126949292-126949314 GTGTGTGTGTGTAGTGAAAAGGG + Intergenic
1015002238 6:128232148-128232170 GTGTGTATGTGTGGGGACGTGGG - Intronic
1015275249 6:131377394-131377416 GTGTGTGTTTGTCGGGTAAAGGG + Intergenic
1015283651 6:131460383-131460405 GTGTGTGTATGTGTTGACAGAGG + Intergenic
1015647002 6:135403149-135403171 GAGTGTGTATGTGTAGGAATTGG + Intronic
1015980632 6:138834888-138834910 GTGTGTGTGTGTGTGTAAACGGG - Intronic
1016118229 6:140314555-140314577 GTGTGTGTGTGTGTGGAGAGAGG + Intergenic
1016323790 6:142876849-142876871 GTGTGTGTGTGTGTGAAGATGGG - Intronic
1016404602 6:143716882-143716904 ATGTGTGGATCTGGGGACATAGG + Intronic
1016587141 6:145701894-145701916 TTGTGTGTGTGTGTGGCAATTGG - Intronic
1016652721 6:146481709-146481731 GTGTGTATGTGTGCTGAAATGGG - Intergenic
1016763773 6:147769442-147769464 GTGTGTGTTTGGGAGGAAATGGG - Intergenic
1016838546 6:148503823-148503845 GTGTGTGTATGGGGAAAAAGTGG + Intronic
1017279051 6:152604188-152604210 GTGTGTGTATGTAGTGGTATTGG + Intronic
1017821630 6:158053495-158053517 GGGTGTGTAGGTGGGTGAATGGG - Intronic
1018108195 6:160509052-160509074 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1018186814 6:161272693-161272715 GTGTGTGTGTTTAGGGAAATGGG - Intronic
1018204730 6:161426638-161426660 GTGTGTGTGTGTGTGTAAAGGGG - Intronic
1018221346 6:161582963-161582985 GTGTGTGTGTGTGTTGGAATAGG - Intronic
1018296950 6:162358156-162358178 GTGTGTGTTGGGGGAGAAATAGG + Intronic
1018522018 6:164659810-164659832 GTGTGTGTGTGTGGTGTGATGGG + Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019262646 7:90229-90251 CTTTGTGTATGTTGGGAAACAGG + Intergenic
1019487238 7:1294975-1294997 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487248 7:1295026-1295048 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487307 7:1295317-1295339 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487325 7:1295400-1295422 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019543194 7:1560612-1560634 GAGTGTGTGTGTGGGGGAAGGGG - Intronic
1019957260 7:4425203-4425225 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1020119249 7:5493685-5493707 GTGTGTGTGTGTGGAGACAGGGG + Intronic
1020288218 7:6702375-6702397 GTGTGTGTGTGTGTGGAGTTTGG - Intronic
1020288229 7:6702479-6702501 GTGTGTGTGTGTGTGGAGTTTGG - Intronic
1020344604 7:7149374-7149396 GTGCGTGTATGTGCGCACATGGG + Intergenic
1020531333 7:9340453-9340475 GTGTGTGTGTGTGTGAATATTGG - Intergenic
1020614223 7:10438358-10438380 GTGTGTGTGTGTGGAGGAATAGG - Intergenic
1020849546 7:13333817-13333839 GTGTGTGTAGGTGGGGCAAGGGG - Intergenic
1020994741 7:15249321-15249343 TTGTGTGTAAGTGTGGAAAGAGG + Intronic
1021095192 7:16527458-16527480 GTGTGTGTGTGTGTGGATGTGGG + Intronic
1021435563 7:20610568-20610590 TTGTGTGCATGTGGGGAAAGGGG + Intergenic
1021487840 7:21186847-21186869 GTGTGTGTGTGTTGGGAGACTGG - Intergenic
1021782774 7:24122261-24122283 GTGTGTGTGTGTGTAGCAATGGG - Intergenic
1021946110 7:25729079-25729101 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1021974366 7:25997315-25997337 CTGTGTGAACATGGGGAAATGGG + Intergenic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022158255 7:27681929-27681951 GTGTGTGTGTGTGTGTAAAATGG + Intergenic
1022211282 7:28212452-28212474 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1022388027 7:29919806-29919828 GGGTGAGGATGTGGAGAAATTGG - Intergenic
1022616163 7:31932573-31932595 GGGTGAGGATGTGGAGAAATAGG + Intronic
1022956698 7:35387444-35387466 GTGTGTGCATATGTGCAAATTGG + Intergenic
1023866504 7:44240933-44240955 GTGTGTGTAGTTCTGGAAATAGG - Intronic
1023951491 7:44849300-44849322 ATGTGTGTATGTGGGGGCAGAGG + Intergenic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024296718 7:47849695-47849717 GGTTGTGTATGTGGTGAAAAGGG + Intronic
1024337072 7:48219871-48219893 GTGTGTGTGTTTGGGGAAGGTGG - Intronic
1024766362 7:52665695-52665717 GGGTGAGTATGTGAAGAAATTGG - Intergenic
1024878784 7:54060435-54060457 ATGTGTGTATGTATGGAAAGGGG - Intergenic
1024883535 7:54115907-54115929 GTGTGTGTATGTCTGGAAATTGG - Intergenic
1025090307 7:56057372-56057394 GTGTGTGTCTGTGTGGAGAATGG + Intronic
1026092124 7:67308997-67309019 CTGTGAGTTTGTGGGGACATTGG + Intergenic
1026134606 7:67648593-67648615 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1026312347 7:69197382-69197404 TTGTGTGTGTGTGTGGAGATGGG - Intergenic
1026500043 7:70936329-70936351 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1026607549 7:71828726-71828748 GTGTGTGTGTGTGTGTAATTTGG + Intronic
1026678500 7:72447901-72447923 GTGTGTGTATGTGTGTACATGGG - Intergenic
1026679569 7:72455349-72455371 GTGTGTGTGTGTGTGTACATAGG + Intergenic
1026871443 7:73855176-73855198 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1027331164 7:77095263-77095285 GTGTGTGTGTGTGTGTATATAGG + Intergenic
1027400612 7:77802089-77802111 GTGTTTGTAGGTGGAGAAAGAGG + Intronic
1027490575 7:78819634-78819656 GTATGTGTGTGTGTGCAAATTGG + Intronic
1027500311 7:78941719-78941741 GTGTGTGTGTGTGATGAAATAGG - Intronic
1027560531 7:79723305-79723327 GTGTGTGTATGTCTGGAGAGAGG - Intergenic
1027629523 7:80585309-80585331 GTGTGTGTGTGTGTGGAGGTGGG + Intronic
1027794018 7:82669640-82669662 GTGGGTGTGTGTGTGGAGATAGG + Intergenic
1027963040 7:84970987-84971009 GTGTGTGTATGTGTGTTCATAGG - Intergenic
1027989984 7:85345870-85345892 GTGTGTGTGTTTGGGGGAGTGGG + Intergenic
1028173644 7:87628611-87628633 GTGTGTGTGTGTGTGGAGCTCGG + Exonic
1028270463 7:88782125-88782147 GTGTGTGTGTGTTGTGTAATAGG + Intronic
1028488465 7:91385350-91385372 GTGTGTGTATGTGTGTATGTTGG + Intergenic
1028582708 7:92423845-92423867 GTGTGTGTATGTGGCGTAAGGGG + Intergenic
1028628716 7:92908586-92908608 CTGTCTGTGTGTGTGGAAATTGG - Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1029100235 7:98123690-98123712 GTGTGTGTATATATGAAAATTGG - Intronic
1029205834 7:98869180-98869202 GTGTGTGTGGGTGGGGGAGTGGG - Intronic
1029367413 7:100125632-100125654 GTGTGTGTGTGTGTAGAATTGGG - Intergenic
1029710634 7:102297386-102297408 GTGTGTGTGTGTGTAGAGATGGG - Intronic
1029987899 7:104938467-104938489 GTGTGTGTGTGTGTATAAATAGG - Intergenic
1030073399 7:105716656-105716678 GTGTGTGTGTGTGCAGAGATAGG - Intronic
1030189847 7:106800111-106800133 GTGTGTGTTTGTGTGTAAAGTGG - Intergenic
1030318935 7:108144335-108144357 GAGTGAGTAGGTGAGGAAATGGG - Intergenic
1030517306 7:110554025-110554047 GTGTGTGTATGGGGTGAAAGGGG - Intergenic
1030646471 7:112066971-112066993 GTGTGTGTGTGTGTGGAGACGGG - Intronic
1030812939 7:113997742-113997764 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1031003627 7:116446836-116446858 TTTTGTGTATGTGGGGAGAGAGG - Intronic
1031009977 7:116515916-116515938 GTGTGTGTGTGTGTGGATGTAGG - Intergenic
1031093186 7:117387353-117387375 ATGTGTGTATGTGGGGGTTTTGG - Intronic
1031494793 7:122433150-122433172 GTGTGTGTGTGTGTGGAGATGGG + Intronic
1031540825 7:122992688-122992710 GTGTGTGATTGTGGGGAGAGGGG + Intergenic
1031791019 7:126104533-126104555 GTGTGTGTGTGTGTAGAACTGGG + Intergenic
1032263999 7:130357982-130358004 GTGTGTGTGTGTTTAGAAATAGG + Intronic
1032634046 7:133686717-133686739 GGGTGTGGATGTGGTGAAAAGGG + Intronic
1032714900 7:134499629-134499651 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1032773217 7:135080935-135080957 GTGTGTGTGTGTGTGTAATTAGG - Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1032841568 7:135718062-135718084 GTGTGTGTGTGTGTAGGAATTGG - Intronic
1033144230 7:138857235-138857257 GTGTGTGTATGTGGGTGGGTGGG - Intronic
1033176913 7:139133342-139133364 GTAGGTGTATCTGTGGAAATAGG + Intergenic
1033177314 7:139136639-139136661 GTGTGTGTGTGTGGAGACAGGGG + Intronic
1033240717 7:139677203-139677225 GTGTGTGTATGTAGAGAGAGAGG + Intronic
1033608778 7:142946094-142946116 GTGTGTGTGATTGGGGAATTGGG - Intronic
1033817611 7:145093894-145093916 GTGTGTGTATGTGTGCACACAGG + Intergenic
1034306980 7:150051369-150051391 GTGTGTGTGTGTGTGGATAAGGG - Intergenic
1034310180 7:150080553-150080575 GTGTGTGTGTGTGTGAAATTTGG + Intergenic
1034392134 7:150794900-150794922 GTGTGTGTGTGTGTGGTAGTAGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034494717 7:151412518-151412540 GTGTGTGTAGGTGGTGACAGAGG + Intergenic
1034681823 7:152934722-152934744 GTGTGTGCATGTGTGCATATGGG - Intergenic
1034799870 7:154049314-154049336 GTGTGTGTGTGTGTGGATAAGGG + Intronic
1034874973 7:154717367-154717389 GTGTGTGTTTGTGTGCAAGTGGG - Intronic
1034895518 7:154873989-154874011 GTGTGTGTATGTGTGCATGTGGG - Intronic
1034937146 7:155207606-155207628 GTGTGTCTGTGTGTGGGAATGGG + Intergenic
1034937166 7:155207726-155207748 GTACGTGTGTGTGTGGAAATCGG + Intergenic
1034937178 7:155207811-155207833 GAGTGTGTGTGTGTGGGAATGGG + Intergenic
1034937184 7:155207851-155207873 GTGAGTGTGTGTGTGGGAATGGG + Intergenic
1034937262 7:155208305-155208327 GTGTCTGTGTGTGTGGGAATGGG + Intergenic
1034937268 7:155208339-155208361 GTGTGTGTCTGTGGGGGAATGGG + Intergenic
1034937272 7:155208361-155208383 GTGTGTGTGTGTGTGGGAATGGG + Intergenic
1034937294 7:155208443-155208465 GTGTCTGTGTGTGGGGGAATAGG + Intergenic
1034937302 7:155208473-155208495 GTGTATGTGTGGGGGGGAATGGG + Intergenic
1034937305 7:155208497-155208519 GTGTGTGTGTGTGTAGGAATGGG + Intergenic
1034937365 7:155208762-155208784 ATGGGTGTGTGTGGGGGAATGGG + Intergenic
1034937391 7:155208898-155208920 GAGTGTGTCTGTGTGGGAATGGG + Intergenic
1034937400 7:155208969-155208991 GTGTGTCTGTGTGTGGGAATGGG + Intergenic
1035399086 7:158553114-158553136 GTGTGTGTACATGGGGAAGGTGG - Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1035708876 8:1697470-1697492 GTGTGTGCATGTGCCGAAAATGG + Intronic
1035894020 8:3377181-3377203 GTGTTTTTTTGTGTGGAAATGGG + Intronic
1036216233 8:6882378-6882400 GTGTGTGTATGTGTGCATTTTGG + Intergenic
1036960403 8:13239106-13239128 GTGTGCGTATCTGGGGTCATAGG + Intronic
1037209178 8:16364157-16364179 GTGTGTGTATGTGTGTAATATGG - Intronic
1037579758 8:20237359-20237381 GTGTGTGGATGTGTGGATGTGGG - Intergenic
1037611868 8:20482700-20482722 GTGTGTGTATGTGTGTGTATAGG + Intergenic
1037647606 8:20807287-20807309 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1038154616 8:24977074-24977096 TGGTGAGGATGTGGGGAAATTGG - Intergenic
1038198642 8:25391235-25391257 GTGTGTGTGTGTGTGTAAATGGG + Intronic
1038313445 8:26463385-26463407 GTGTGTGTGTGTGTGGAGACAGG + Intronic
1038680261 8:29660475-29660497 GTGTATGTATGTGTGTGAATAGG - Intergenic
1038871122 8:31495014-31495036 GAGAGTGTATGTGGGGAAGGGGG + Intergenic
1038918135 8:32050543-32050565 GTCTGTGGAGGTGTGGAAATGGG - Intronic
1039161581 8:34627522-34627544 GTGTGTGTGTCTGGGGGAACAGG - Intergenic
1039352781 8:36780740-36780762 GTGTGTGTGTGTAGTGAAAAGGG - Intergenic
1039416901 8:37402908-37402930 GTGTGTGTGTGTGTAAAAATAGG - Intergenic
1039596328 8:38793020-38793042 GTGTGTGTGTTTGGGGAAGGGGG - Intronic
1039672886 8:39623486-39623508 ATGTGTGCATGTGGTGAAAAGGG - Intronic
1039752462 8:40490994-40491016 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1039754988 8:40513263-40513285 GAGTGTTTATGTGGGGAAGGAGG + Intergenic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1039827599 8:41188401-41188423 GTGTGTGTGGGTGGGGGAATGGG + Intergenic
1039914198 8:41847743-41847765 GGGTGCGTATGTGGGGAATCTGG - Intronic
1040505833 8:48046769-48046791 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1040660248 8:49565174-49565196 GTGTGTGTGTGTGTAGAGATGGG + Intergenic
1040833150 8:51700575-51700597 GTGTGTATATGTGTGTATATGGG - Intronic
1040897544 8:52384486-52384508 GTGTGTTTGTGTGTGAAAATGGG - Intronic
1041087386 8:54269324-54269346 GTGTGTGTATGTGTAGGAAATGG + Intergenic
1041673936 8:60518703-60518725 GTGTGTGTGTGTGTGGAAATTGG + Intronic
1041819348 8:62012195-62012217 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1042293070 8:67189963-67189985 TGGTGAGGATGTGGGGAAATTGG + Intronic
1042741543 8:72052940-72052962 GTGTGTGCATGTGTGGGAAGTGG + Intronic
1042757124 8:72227327-72227349 GTTTGTGTATGTGTGGGAAGTGG + Intergenic
1042816628 8:72884618-72884640 ATTTGTGTGTGTTGGGAAATAGG + Intronic
1042860558 8:73309064-73309086 GTGTGTGTATGTGGGTAAGGGGG - Intronic
1042931089 8:74014806-74014828 GTGTGTGTGTGTGTGTAAACTGG - Intronic
1043077969 8:75726517-75726539 GTGTGTGTATGTGTGTGTATGGG - Intergenic
1043144496 8:76635479-76635501 GTGTGTGTGTGTGGTTAATTAGG + Intergenic
1043158992 8:76822004-76822026 GTGTGTGTATGTGGAGAGACAGG - Intronic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1043235436 8:77859606-77859628 GAGTGTGTATGTGAGTGAATTGG - Intergenic
1043316579 8:78929819-78929841 GTGTGTGTGTGTTTGGAAATGGG + Intergenic
1043563041 8:81517095-81517117 GTGTGTGTGTGTGTGGAGACGGG - Intergenic
1043668615 8:82851229-82851251 TTGTGTGTATGTGGGGGAGGGGG + Intergenic
1044270113 8:90231950-90231972 TGGTGTGGATGTGGAGAAATTGG - Intergenic
1044309034 8:90671335-90671357 GTGTGTGTGTTGGGGGAAAAGGG + Intronic
1044690708 8:94874963-94874985 TGGTGAGGATGTGGGGAAATTGG + Intronic
1044727928 8:95208172-95208194 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
1044876850 8:96677307-96677329 TGGTGTGTATGTGGTGAAAAGGG - Intronic
1045556182 8:103216937-103216959 GTGTGTGTATGTGCGGCATGGGG - Intronic
1045977213 8:108142993-108143015 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1046008083 8:108510048-108510070 GTGTGTGTGTGTGTGGATATGGG + Intergenic
1046214270 8:111122475-111122497 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1046238924 8:111464706-111464728 TGGTGTGGATGTGGGGAAAAGGG + Intergenic
1046405465 8:113767157-113767179 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1046406852 8:113784922-113784944 ATGTGTGTATGTGTGGGGATTGG + Intergenic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1046792171 8:118333934-118333956 GTGTGTGTGTGTGTGCACATTGG + Intronic
1046897672 8:119490008-119490030 GTGTGTGTATATGTGCAAGTGGG - Intergenic
1047106119 8:121732371-121732393 GTGTGTGGATGTGGTGAAAAGGG - Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1047677150 8:127214789-127214811 GTGTGTGTATGTGGGGTGTATGG + Intergenic
1047848738 8:128833154-128833176 GTGTGTGTGTGTGTGTAAAGTGG + Intergenic
1047915234 8:129575826-129575848 GTGTGTGTATGTGTGTGACTGGG - Intergenic
1048296190 8:133215974-133215996 GTGTGTGTGTGTAGTGTAATGGG - Intronic
1048296428 8:133217929-133217951 GTGTGTGTGTGTGTGGAGAAGGG - Intronic
1048349526 8:133604886-133604908 TGGTGTGAATGTGGAGAAATTGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048610601 8:136018212-136018234 GTGGGTTTAAGTGGAGAAATAGG + Intergenic
1048843740 8:138587134-138587156 GTGTGTGTATGTGGGTGGTTGGG + Intergenic
1049145628 8:141000082-141000104 GTGTGTGTGTGTGTGTGAATTGG - Intronic
1049272244 8:141702219-141702241 GTGTGTGTGTTGGGGGAGATGGG + Intergenic
1049342851 8:142122865-142122887 GTGTGTGTGTGTGTGCACATCGG - Intergenic
1049378755 8:142301662-142301684 GTGTGTGTGTGAGGGAAAAAGGG + Intronic
1049379070 8:142303034-142303056 GTGTGGGCATCTGGGGACATGGG + Intronic
1049393742 8:142386239-142386261 GTGTGGCTATCTGGGGAAATGGG + Intronic
1050130808 9:2410036-2410058 TGGTGAGGATGTGGGGAAATTGG - Intergenic
1050181756 9:2930639-2930661 TGGTGAGTATGTGGAGAAATTGG - Intergenic
1050230672 9:3522620-3522642 GTGTGTGTTTGTGTTTAAATGGG - Intronic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050615959 9:7402054-7402076 GTGTGTGTGTGTTGGGAAAGGGG - Intergenic
1050641126 9:7668640-7668662 GTGTGTGTGTGTGTGCCAATTGG - Intergenic
1050824162 9:9923142-9923164 GTGTGTGTATGTACAGAAAAAGG + Intronic
1051199876 9:14605338-14605360 TGGTGAGGATGTGGGGAAATTGG - Intergenic
1051205237 9:14681743-14681765 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1051329225 9:16006232-16006254 GTGTTAGGATGTGGGGAAACTGG - Intronic
1051433054 9:17000052-17000074 GTGTGTGTAGGTGGGGAGGGTGG - Intergenic
1051872579 9:21755785-21755807 GTGTGTGTATGTGTGTAAAGTGG - Intergenic
1051997386 9:23234196-23234218 GTGTGTGTGTGTGTGGACATGGG + Intergenic
1052049639 9:23830587-23830609 GTGTGTGTAAGTGGGGGGCTGGG - Intergenic
1052049644 9:23830595-23830617 GTGTGTGTGTGTGTGTAAGTGGG - Intergenic
1052266489 9:26579494-26579516 GTGTGTGCAGCTGGGGAACTAGG - Intergenic
1052524837 9:29602712-29602734 GTGTGTGTGTGTGTGGAGAAGGG + Intergenic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052809999 9:33049757-33049779 GTGTGTGTGTGTGTGGAAATGGG - Intronic
1052869874 9:33494039-33494061 GTATGTGTATGTGGGGTATGTGG + Intergenic
1053167457 9:35854467-35854489 GTGTGGGGAAGTGGGGAAAGAGG + Exonic
1053171652 9:35891282-35891304 GTGTGTGTGTGTGTGTAGATAGG - Intergenic
1053366494 9:37526073-37526095 GTGTGTGTATGTGTGTACATGGG + Intronic
1053547727 9:39041485-39041507 GTGTGTGTATGTGTGTAGGTGGG - Intergenic
1054753322 9:68930668-68930690 CAGTGTGTGTGTGTGGAAATTGG - Intronic
1054898972 9:70347214-70347236 GTGTGTGTATGTGTGTGTATGGG - Intronic
1055166150 9:73196630-73196652 GTGTGTGTGTGTGTGGAAAAAGG - Intergenic
1055547986 9:77401361-77401383 GTGTGTGTGTGTGTAAAAATTGG + Intronic
1055612133 9:78033401-78033423 GTGTGTGTATGTGTGTGAAACGG - Intergenic
1055666018 9:78553886-78553908 GTGTGTGTATTGAGGGGAATTGG + Intergenic
1055801622 9:80042902-80042924 GTGTGTGCGTGTAGGGGAATGGG - Intergenic
1056138538 9:83652040-83652062 GTTGGTGAATGTGGAGAAATTGG - Intergenic
1056327819 9:85494930-85494952 GTGTGTGTGTGTGGCGAGTTGGG - Intergenic
1056336850 9:85579589-85579611 GTGTGTGTGTGTGGGGCGAGGGG + Intronic
1056831719 9:89922745-89922767 GTGTGTGTATGTGTGTGTATAGG - Intergenic
1056989626 9:91398782-91398804 GTGTGTGTGTGTGTGGTATTGGG - Intergenic
1057017673 9:91666937-91666959 GTGTGTGTGTGTGTGTACATAGG + Intronic
1057356934 9:94339729-94339751 GTGTGTGTGTGTGTGGAGATGGG - Intergenic
1057373960 9:94501373-94501395 ATTTTTGTATGTGGTGAAATAGG + Intergenic
1057412471 9:94829189-94829211 GTGTGTGTGTGTGTGTAAACTGG - Intronic
1057650818 9:96917914-96917936 GTGTGTGTGTGTGTGTAGATGGG + Intronic
1057668530 9:97067002-97067024 GTGTGTGTGTGTGTGGAGATAGG - Intergenic
1057688515 9:97261019-97261041 GTATGTGTATGTGGGGTATGTGG - Intergenic
1057950816 9:99367951-99367973 GTGTGTGTGTGTTGGGGAAGGGG - Intergenic
1058020335 9:100079407-100079429 GTGTGTGTGTGTGTGTAAAGGGG - Intronic
1058077951 9:100669563-100669585 GAGTGTGTGTGTGGGGAGGTAGG + Intergenic
1058522515 9:105825574-105825596 GTGTGTGTGTGTGCAGAGATGGG + Intergenic
1058704017 9:107624116-107624138 GTGTGTGTGTGTGTTGACATTGG - Intergenic
1058758115 9:108102599-108102621 GTGTGTGTATGTTGGGGAGTAGG + Intergenic
1058933455 9:109745502-109745524 GTGTGTGTGTGTGTAGGAATAGG + Intronic
1058937796 9:109785177-109785199 GTTTATATATGTGCGGAAATAGG + Intronic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059172814 9:112142576-112142598 GTGTGTGTGTGTGAGGAATAGGG - Intronic
1059201914 9:112425910-112425932 GTGTATGTGTGTGTGGAGATGGG + Intronic
1059400449 9:114066399-114066421 GTGTGTGTGTGTGTAGAGATGGG + Intronic
1059502775 9:114769360-114769382 GTCTGTGTATGGAGGTAAATGGG + Intergenic
1059641846 9:116224896-116224918 GTGTGTTTATGTGTAGATATAGG + Intronic
1059662257 9:116413534-116413556 GTGTGTGTGTGTTTAGAAATGGG - Intergenic
1059709575 9:116855238-116855260 GGGTGGGTAGGTGGGGTAATAGG - Intronic
1059712610 9:116883489-116883511 GTGTGTGTGTGTGAGGAAAGAGG - Intronic
1059909151 9:119023148-119023170 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1060155154 9:121314387-121314409 TGGTGTGTATGTGGGGAGGTTGG + Intronic
1060478535 9:124002423-124002445 GTGTGTGTGTGTAGATAAATAGG + Intronic
1060782440 9:126422626-126422648 GTTTGTGTATAAGGGGAAAGTGG + Intronic
1060982439 9:127801466-127801488 GTGTGTGTGTATGGGGGAAGGGG + Intronic
1061318144 9:129810339-129810361 GTGTGTGTGTGTGGGGGGGTGGG + Exonic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061665900 9:132161180-132161202 GTGGGTGGATTTGGGGAGATGGG - Intergenic
1062013468 9:134279658-134279680 GTGTGAGTGTGTGGGGATGTGGG - Intergenic
1062021314 9:134320705-134320727 GTGTGTGTGTGTTGGGGACTGGG + Intronic
1062107016 9:134761188-134761210 CTGTGTGCATGTGGGGGGATGGG - Intronic
1062132907 9:134909701-134909723 GTGTGTCTGGCTGGGGAAATGGG + Exonic
1062300655 9:135866200-135866222 GTGAGGGTATTTGGGGGAATTGG - Intronic
1062328480 9:136024208-136024230 GTGTGTGTGTGTGAGGACAGAGG + Intronic
1062328504 9:136024429-136024451 GTGTGTGTGTGTGAGGACAGAGG + Intronic
1062715199 9:138006706-138006728 GTGCGTGTGTGTGGGGAAGGCGG + Intronic
1185618313 X:1436716-1436738 GTGTCTGTCAGTGGGTAAATGGG - Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185769013 X:2750669-2750691 GTGTGTGTGTGTGTGCATATGGG - Intergenic
1185889291 X:3810080-3810102 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1185937296 X:4273147-4273169 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
1186057058 X:5661094-5661116 GTGTGTGTATGTGTGTAAGAGGG + Intergenic
1186132874 X:6487698-6487720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1186378024 X:9028798-9028820 GTGGCTGTATGTTGGGAAGTTGG - Intronic
1186393989 X:9189420-9189442 GTGTGTGTGTGTGTGAAAAAAGG - Intergenic
1186527497 X:10262495-10262517 GTGTGTATGTGTGTGTAAATGGG - Intergenic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1186979702 X:14945704-14945726 GTGTGTGTGTGTGGAGAACAGGG + Intergenic
1187003104 X:15202208-15202230 GTGTGTGTGTGTGTGTAGATTGG - Intergenic
1187045241 X:15641662-15641684 GTGTGTGTGTGTGTGTAAACAGG + Intronic
1187181998 X:16951494-16951516 GTGTGTGTGTGTGTGTAGATGGG - Intronic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1187656413 X:21479960-21479982 GTGCATGTGTGTGGGGATATCGG - Intronic
1187749960 X:22451643-22451665 GTGTGTGTATGGTGAGAGATAGG - Intergenic
1187754695 X:22509747-22509769 TTGTGCTTGTGTGGGGAAATAGG - Intergenic
1187797956 X:23024925-23024947 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1187867895 X:23740699-23740721 GTGTATGTATTGGGGGAGATCGG - Intronic
1187907501 X:24081314-24081336 GTGTGTGTGTGTGGTGAATAAGG - Intergenic
1187946888 X:24434698-24434720 TGGTGAGGATGTGGGGAAATTGG + Intergenic
1188042631 X:25387606-25387628 GTCTGTGCATGTGGGGACAAGGG - Intergenic
1188091745 X:25973057-25973079 GTGTGTGTATGTGTGACTATTGG - Intergenic
1188202955 X:27315742-27315764 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1188256798 X:27971639-27971661 GTGAGTGTCTGTTTGGAAATGGG + Intergenic
1188401917 X:29756264-29756286 ATGTTTGTATATGGGAAAATTGG + Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188732498 X:33668255-33668277 GTGTGTGTGTGTGTGTATATGGG + Intergenic
1188805481 X:34583384-34583406 GTGTGTGTATGATGGTAAGTGGG - Intergenic
1188947595 X:36326294-36326316 GTGTGTGTGTGTTTGGAAATTGG - Intronic
1189260325 X:39674047-39674069 GTGTGTGTATGTGGACAAGTGGG - Intergenic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1189675004 X:43452677-43452699 GTGTGTGTGTGTGTGTAGATGGG + Intergenic
1190057449 X:47189928-47189950 GTGTGTGTATGTTGGGGCGTGGG + Intergenic
1190140920 X:47843424-47843446 GTGTGTGTGTGTGTAGATATAGG - Intronic
1190265631 X:48826187-48826209 GTGTGTGTGTGTGGGAGAGTTGG - Intergenic
1190324010 X:49195563-49195585 GTGTGTGTATGTGAGGGAAGAGG + Intronic
1190428567 X:50355561-50355583 GGGTGTGGATGTGGTGAAAAAGG - Intergenic
1190435952 X:50425512-50425534 GTGTGTGTATTTGGGAGAACAGG - Intronic
1190627650 X:52352236-52352258 GTGTGTGTGTGTGTAGACATGGG + Intergenic
1190833967 X:54083426-54083448 GTGTGTGTGTGTGTGGAGATGGG - Intronic
1190833989 X:54083627-54083649 GTGTGTGTATGTGTGGATACAGG - Intronic
1190920874 X:54851436-54851458 GTGTGTGTGTGTGTGTAAACTGG - Intergenic
1190930524 X:54946017-54946039 GTGTGTGTATGTGTGTGTATAGG + Intronic
1191062300 X:56311999-56312021 GTGTGCGCATGTGGATAAATAGG + Intergenic
1191193897 X:57700123-57700145 GTATGTGTATGTGGTGGAAGGGG - Intergenic
1191783279 X:64891608-64891630 GTGTGTGTATGTGTGCACACGGG - Intergenic
1192002815 X:67174074-67174096 TTCTGTGGATGTGGTGAAATCGG + Intergenic
1192178071 X:68898359-68898381 GTATGTGTGTGTGGGGGAGTTGG + Intergenic
1192412484 X:70946424-70946446 TTGTCTTTATGTGGGGAAAAAGG + Intergenic
1192423485 X:71054426-71054448 GTGTGTGTGTGTGTAGAGATGGG - Intergenic
1192560281 X:72123802-72123824 GTGTGTTTGTGTGGGAAAGTAGG - Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1192826677 X:74704495-74704517 CTGTGTGTTTGTGGGGGAAATGG - Intergenic
1193197112 X:78645196-78645218 GTGTGTGTGTGTGGTGTTATAGG - Intergenic
1193460354 X:81784276-81784298 TGGTGTGGATGTGGGGAAAATGG - Intergenic
1194592723 X:95819204-95819226 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1194744296 X:97611552-97611574 GTGTGTGTGTGTGGTGGAAAGGG + Intergenic
1194933940 X:99924501-99924523 GTGTGTGTGTGTTGGGAGAGGGG - Intergenic
1194941222 X:100013400-100013422 GTGTGTATATGAAGGGGAATGGG - Intergenic
1195269045 X:103213019-103213041 GTGTGTGTGTGTATGGAGATGGG + Intergenic
1195270144 X:103220880-103220902 GTGAGTATATGTGGGAAAAGCGG - Intergenic
1195502795 X:105621961-105621983 GTGTGTGTATATGGGGGGATGGG + Intronic
1195594602 X:106673675-106673697 GTGTGTGTGTGGGGGGGGATGGG - Intronic
1195653379 X:107310788-107310810 TGGTGTGGATGTGGAGAAATTGG + Intergenic
1195848050 X:109249445-109249467 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1195990168 X:110674450-110674472 GTGTGTGTGTGTGTGGTAAAGGG - Intronic
1195997276 X:110743864-110743886 GTGTGTGTTTGTGGGGATGGTGG + Intronic
1196164933 X:112528451-112528473 GTGTGTGTGTGTTGGGATAAGGG - Intergenic
1196282308 X:113836281-113836303 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196408038 X:115386328-115386350 GTGTGTGTGTGTGTGGAGATGGG + Intergenic
1196610147 X:117704487-117704509 GTGTGTGTGTGTGTGCAAAAAGG - Intergenic
1196632544 X:117959960-117959982 TTGAGTGTATGTGGGCAATTGGG - Intronic
1196635038 X:117992532-117992554 GTGTGTGTATGTGTGTTGATGGG - Intronic
1196656062 X:118218216-118218238 GTATGTGTATGTGTGTATATGGG + Intergenic
1196701902 X:118678961-118678983 GTGTGTGTGTGTGTGGAGACGGG + Intronic
1197055049 X:122108430-122108452 GTGTGTGTGTGTGTGGCAAGGGG + Intergenic
1197122900 X:122913480-122913502 GTGTGTGCATTTGAGGAAGTAGG + Intergenic
1197216404 X:123870942-123870964 GTGTGTGTGTGTGAGGGAGTCGG + Intronic
1197392867 X:125889994-125890016 GTGTGTGTATATGTGTATATAGG + Intergenic
1197423062 X:126262196-126262218 GTGTGTGTGTGTGTGCAACTGGG + Intergenic
1197436784 X:126438521-126438543 GTGTGTGCATGTGTGTAAAATGG - Intergenic
1197466819 X:126814933-126814955 GTGTGTGTGTGTGGTGAAATGGG - Intergenic
1197529443 X:127605160-127605182 GTGTGTGTGTGTGTGTAAAGGGG - Intergenic
1197570430 X:128144269-128144291 TTGTGTGGATGTGGTGAAAAGGG + Intergenic
1197693578 X:129527403-129527425 GTGTGTGTGTGTGGTGAAAATGG - Intergenic
1197724196 X:129765510-129765532 TAGTGAGTATGTGAGGAAATGGG - Intronic
1197901140 X:131373674-131373696 GTGTGTGTGTGTGGAGAGAGAGG + Intronic
1198029811 X:132743959-132743981 GTGTGTGTGTGTGGAGAAACGGG + Intronic
1198134631 X:133736236-133736258 TGGTGTGGATGTGGAGAAATTGG + Intronic
1198182272 X:134221426-134221448 GTGTGTGTGTGTGTGTAGATGGG - Intergenic
1198194805 X:134349411-134349433 GTGTGTGTGTGTGTAGAAACAGG - Intergenic
1198260771 X:134962856-134962878 GTGTGTGTGTGTGGTGTAATGGG - Intergenic
1198318178 X:135490589-135490611 GTGTGTGTATCTGGGGTAAGGGG - Intergenic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1198554394 X:137777314-137777336 GTGTGTGTGTGTGTAGAAGTGGG + Intergenic
1198557428 X:137809962-137809984 TTGTAGGTATCTGGGGAAATTGG - Intergenic
1198705964 X:139448321-139448343 CTGTGTGTAAGTGGAGAACTTGG + Intergenic
1199012322 X:142771897-142771919 GTGTGTGTGTGTGTAGAAATGGG + Intergenic
1199065564 X:143413128-143413150 TTGTGTGGATGTGGTGAAACGGG - Intergenic
1199088610 X:143663808-143663830 GTGTGTGTATGTGGCTACAGTGG - Intergenic
1199165644 X:144671964-144671986 GTGTGTGTATTTTAGGCAATTGG + Intergenic
1199351837 X:146810640-146810662 GTGTGTTTTGGTGGGGAAAGAGG + Intergenic
1199352070 X:146813853-146813875 GTGTGTTTTGGTGGGGAAAGAGG - Intergenic
1199776314 X:151015068-151015090 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1200042894 X:153382503-153382525 GTGTTTGTGTGTGGGGAATTTGG - Intergenic
1200800465 Y:7382527-7382549 GTGTGTGTGTGTGTGTAGATAGG + Intergenic
1201754566 Y:17471994-17472016 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1201799199 Y:17936302-17936324 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1201802354 Y:17969654-17969676 TTGAGAGTATGTGGAGAAATTGG - Intergenic
1201846986 Y:18433991-18434013 TTGAGAGTATGTGGAGAAATTGG - Intergenic
1202175126 Y:22091561-22091583 TGGTGTGGATGTGGAGAAATAGG + Intronic
1202216236 Y:22494822-22494844 TGGTGTGGATGTGGAGAAATAGG - Intronic
1202326950 Y:23701242-23701264 TGGTGTGGATGTGGAGAAATAGG + Intergenic
1202352933 Y:24013239-24013261 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1202517846 Y:25656876-25656898 TTGAGAGTATGTGGAGAAATTGG - Intergenic
1202543819 Y:25968810-25968832 TGGTGTGGATGTGGAGAAATAGG - Intergenic