ID: 1151499493

View in Genome Browser
Species Human (GRCh38)
Location 17:74479943-74479965
Sequence CATTGTGACTGGGGTAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151499479_1151499493 16 Left 1151499479 17:74479904-74479926 CCTACTGTGTGCCAGGCCTGTGC 0: 4
1: 11
2: 69
3: 281
4: 1005
Right 1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG 0: 1
1: 0
2: 2
3: 11
4: 112
1151499486_1151499493 0 Left 1151499486 17:74479920-74479942 CCTGTGCTGGGCCCTGGGGACAA 0: 1
1: 2
2: 19
3: 77
4: 591
Right 1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG 0: 1
1: 0
2: 2
3: 11
4: 112
1151499483_1151499493 5 Left 1151499483 17:74479915-74479937 CCAGGCCTGTGCTGGGCCCTGGG 0: 3
1: 0
2: 41
3: 200
4: 1098
Right 1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG 0: 1
1: 0
2: 2
3: 11
4: 112
1151499477_1151499493 24 Left 1151499477 17:74479896-74479918 CCTGAGCACCTACTGTGTGCCAG 0: 5
1: 38
2: 147
3: 335
4: 936
Right 1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG 0: 1
1: 0
2: 2
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151499493 Original CRISPR CATTGTGACTGGGGTAGACT GGG Intronic
901690440 1:10969780-10969802 GATTGTGACTGGGGTGGGCGTGG + Intronic
902068676 1:13712867-13712889 CATTGTCTCTTGGTTAGACTGGG + Intronic
902901283 1:19518017-19518039 CTTCGTGACTGGGGCAGACCAGG + Intergenic
907470435 1:54670417-54670439 CCTTGTGACGGGGGCAGCCTTGG + Intronic
911869821 1:103082423-103082445 CATCGTGACTGGGGTATAGGAGG - Intronic
912079510 1:105917577-105917599 CATTTTGACTAGAGTAGTCTCGG + Intergenic
913482180 1:119299347-119299369 CAGGGTGACTGGGCTAGGCTGGG - Intergenic
915832642 1:159145573-159145595 CAGTTTGACTGGGCTAGACTTGG - Intronic
917792597 1:178508822-178508844 GAATGAGACTGGGTTAGACTGGG + Intergenic
921779196 1:219141471-219141493 CAATGTGATTGGGGTATACGAGG - Intergenic
922183588 1:223255537-223255559 CATTGGGGCTGGGGGAGCCTGGG + Intronic
1065612591 10:27487050-27487072 CGTTGTAACTGGGGAAGACTTGG - Intergenic
1066537292 10:36405729-36405751 CATTGTGGCTGTGGTCTACTGGG + Intergenic
1071467607 10:85955776-85955798 CACTGTGACTGTGGCAGACAGGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1076449615 10:130547661-130547683 AATTGTGACTGGGGAAGAACAGG + Intergenic
1078535078 11:12166787-12166809 GACTGTGACAGGGGTAGTCTGGG + Intronic
1079424452 11:20326855-20326877 CCTTGGAACTGGGGTAGATTTGG - Intergenic
1084724315 11:70930866-70930888 TATTTTGCCTGGGGTAGTCTGGG + Intronic
1085313841 11:75531527-75531549 CATTGGGACTGTGGGTGACTTGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087923706 11:103895637-103895659 GATTTAGACTGGGCTAGACTAGG + Intergenic
1089466844 11:118691005-118691027 CTGTGTGACTGGGGCAGAGTGGG - Intergenic
1089639929 11:119841193-119841215 CATTGTGGCTGTGGTAGTCAGGG - Intergenic
1095991704 12:48039233-48039255 CATTGTGGCTGAGGCAGAGTGGG + Intergenic
1096028386 12:48388124-48388146 CATTGAGCCTGGTGTGGACTGGG + Intergenic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1100098700 12:91076241-91076263 CATTGTTACTGAGGAACACTGGG - Intergenic
1100923968 12:99522923-99522945 CAAAGAGACTGGGGGAGACTTGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103214315 12:119189812-119189834 CAGAGTGACTGGGGTTGGCTAGG - Intronic
1105469204 13:20676593-20676615 CAGTGAGACAGGGGTACACTTGG - Intronic
1106318108 13:28613113-28613135 GATTCTGAATGGGGTAGACAGGG - Intergenic
1107725265 13:43292850-43292872 GATGGTGACTGGGGTAGAAATGG - Intronic
1110319673 13:74147457-74147479 CATTGTGAATCTGGGAGACTGGG + Intergenic
1114196192 14:20478446-20478468 CAGTGTGAATTGGGTAGATTAGG + Intergenic
1119271415 14:73308326-73308348 TATTGAGACTGGGAAAGACTAGG + Intronic
1119528265 14:75340604-75340626 CCTTATCACTTGGGTAGACTGGG - Intergenic
1127382206 15:58439792-58439814 CAGTGAGCCTGGGGTAGACTTGG + Intronic
1128056848 15:64706101-64706123 GGTGGTGACTGGGGTAGACAGGG - Intergenic
1129334866 15:74845780-74845802 CCTTGTGAATGGGGTAGTGTGGG - Intronic
1130993810 15:88892955-88892977 CAAGGTGACTGGGCTGGACTTGG - Intronic
1131225182 15:90618710-90618732 AATGGTGACTCTGGTAGACTTGG - Intronic
1132849217 16:2016915-2016937 CACTGTGACAGGGGCAGAATGGG - Intronic
1134835215 16:17355476-17355498 CATAGTCCCTGGGGTAGACTGGG + Intronic
1137315998 16:47323782-47323804 CATGGTGACTGGGCTGGAATTGG - Intronic
1140656319 16:77143701-77143723 CCTTGTGCCTAGGGTAGAGTTGG - Intergenic
1140705292 16:77623190-77623212 CATTCTGGCTGGGGTAAAGTTGG + Intergenic
1142689689 17:1598029-1598051 CATTCTCACTGGGGTAGATATGG - Intronic
1143579801 17:7818834-7818856 TGTTGTGCCTGGGGTAGACTGGG - Intronic
1146916551 17:36681871-36681893 CGTGGTGTCTGGGGAAGACTGGG - Intergenic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG + Intronic
1156700899 18:39823226-39823248 TATTGTAACTGAGGGAGACTGGG + Intergenic
1158133984 18:54185564-54185586 CATTATGAAGGGGGTAAACTAGG + Intronic
1161445856 19:4318778-4318800 CACGGTGGCTGGGGTGGACTAGG + Intronic
1163423864 19:17230152-17230174 CAGTTTGACTGGAGTAGACATGG + Intergenic
1164667513 19:30051336-30051358 CAGTGTGAGTGGGGCAGACAGGG + Intergenic
1167702785 19:51060362-51060384 GATTGTGGATGGGGTAGAGTTGG - Intronic
1168411355 19:56142057-56142079 CATCCTGACTGGGGTAGAGGTGG - Intronic
926238624 2:11068533-11068555 TATGCTGACTCGGGTAGACTGGG + Intergenic
926796531 2:16624062-16624084 CATTGTGACTAGTGGAGAATAGG - Intronic
927920442 2:26968336-26968358 CATTGTTACAGGTATAGACTTGG - Intergenic
931075807 2:58710276-58710298 CATTCTGAATGGGGTAAACAGGG - Intergenic
932391741 2:71397170-71397192 CATTGGGGATGTGGTAGACTGGG + Intronic
933806701 2:86003442-86003464 CCTGGTGGCTGGGGCAGACTGGG + Intergenic
937695518 2:124804286-124804308 CATTATCACAGGGTTAGACTTGG + Intronic
937911775 2:127079066-127079088 CAGTGTGGGTGGGGAAGACTGGG - Intronic
939869789 2:147514288-147514310 CAGTGTGCCTGGGACAGACTGGG + Intergenic
941374339 2:164708341-164708363 CATCCTGACTGGGGTAGGCATGG + Intronic
943176443 2:184481022-184481044 GATGGTGACTGGGGTAAACATGG - Intergenic
943713346 2:191122840-191122862 CTTTGTGACTGGTGTTGACTAGG + Intronic
948466579 2:238154835-238154857 CACTGAGACTGAGGTAGACTAGG + Intergenic
948574427 2:238940646-238940668 CTTTGTGTCTGGCGGAGACTGGG - Intergenic
1176983314 21:15407875-15407897 CATTGTGATTAGGGTAGACTGGG - Intergenic
1181322148 22:22016358-22016380 CATTATGACTGGGGGAAATTTGG - Intergenic
1184256986 22:43292958-43292980 CATTCTGACTGGGGAAGCCTGGG + Intronic
1185172189 22:49300489-49300511 CCTTGTGACTGGAGCAGGCTGGG + Intergenic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
962361837 3:134749356-134749378 GATTTTGGCTGGGGTGGACTGGG + Intronic
968598995 4:1500377-1500399 CACTGGGACTGGGGCAGAGTAGG + Intergenic
973930732 4:55790823-55790845 CTTTAAGATTGGGGTAGACTGGG - Intergenic
975845193 4:78517698-78517720 CAGTGTGCCTGGTGTAGAATAGG + Intronic
976001089 4:80373771-80373793 CATTGTGCTTAGGGTAGCCTAGG + Intronic
976432575 4:84980264-84980286 CCTTTTGACTGTGGAAGACTGGG - Intergenic
980765960 4:137304730-137304752 CAGCATGACTGGGGAAGACTCGG + Intergenic
982637005 4:157909548-157909570 CATTGAGAATGGGGGAGACGAGG - Intergenic
983914487 4:173277281-173277303 CATGGTGGCTGTGGGAGACTCGG + Intronic
985900908 5:2790788-2790810 CTTTGTTACTGGGGCAGACGTGG + Intergenic
986198138 5:5556685-5556707 CATTGTGACTCAGTGAGACTTGG - Intergenic
989759884 5:45000925-45000947 TATTTTGATTGGTGTAGACTAGG - Intergenic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003363189 6:5448091-5448113 CAGTGTGGTTGGGGTAGCCTAGG + Intronic
1006817184 6:36859765-36859787 CATTGTGTCTGTGCTAGACCAGG - Intronic
1008883848 6:56410709-56410731 TGTTATGACTGGGGTAGAGTTGG - Intergenic
1009497345 6:64367650-64367672 CATTGTGAATGGGGTCTACGGGG + Intronic
1010790327 6:80056515-80056537 CACAGTGACTGGAGTATACTTGG + Intergenic
1017258310 6:152359776-152359798 CATGGGGGCTGGGGTAGAATAGG - Intronic
1018150619 6:160933937-160933959 GATTGTGGCTGAGGGAGACTGGG - Intergenic
1019803246 7:3104179-3104201 CAATCTGACTGGGCTCGACTTGG - Intergenic
1025224168 7:57142286-57142308 AATTGTGACTTGTGTACACTTGG + Intergenic
1027697871 7:81433879-81433901 CATTGTGATTGGGCAAGTCTGGG - Intergenic
1031416597 7:121503244-121503266 CATAGTGCCTGGGGAAGGCTGGG - Intergenic
1036969553 8:13340047-13340069 CATTCTGAGTGGGGTGGGCTTGG + Intronic
1037778039 8:21848659-21848681 TTTTGTGACTGGTGTGGACTGGG - Intergenic
1038791701 8:30673787-30673809 CAAGGTGACTGGGGCAAACTTGG + Intergenic
1041621585 8:59976221-59976243 AATTAAGACTGGGGTAGTCTTGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042850076 8:73208243-73208265 CCTGGGGACTGGGGTAGGCTGGG - Intergenic
1047360242 8:124162466-124162488 CTTGGTGACTGGGCAAGACTTGG + Intergenic
1049720189 8:144112077-144112099 CACTGTGACTCGGGGAGACTGGG - Exonic
1049805229 8:144535753-144535775 CTCTGTGACTGGGATACACTGGG + Intronic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1051631658 9:19146325-19146347 GATTCTGATTGGGGTAGTCTCGG + Intronic
1059727442 9:117023292-117023314 CAATGTGGTTGGGGCAGACTGGG - Intronic
1060535051 9:124379344-124379366 CATGGTGACTGGGGCATAGTAGG - Intronic
1062091667 9:134681588-134681610 GCTTGGGACTGGGGTGGACTGGG + Intronic
1188688925 X:33104983-33105005 CATTTTAACTGGGGGAGAATGGG - Intronic
1188874529 X:35413802-35413824 CATTGTGAATGGAGCAGATTTGG - Intergenic
1190688034 X:52891487-52891509 CAGAGTGACTAGGGTAGGCTGGG + Intronic
1190697948 X:52964305-52964327 CAGAGTGACTAGGGTAGGCTGGG - Intronic
1191232424 X:58106543-58106565 TATAGTGACTGGGGTAGGCCGGG - Intergenic
1194469681 X:94277555-94277577 AATTGTGGATGGGGTATACTTGG - Intergenic
1196611380 X:117718444-117718466 AATTCTGCCTGGGGTAGAATGGG - Intergenic
1198963735 X:142207267-142207289 CATTGTTAGTGGGATAGACCTGG - Intergenic
1200942462 Y:8799376-8799398 AAGTGTAACTGGAGTAGACTAGG + Intergenic