ID: 1151500718

View in Genome Browser
Species Human (GRCh38)
Location 17:74486687-74486709
Sequence GTGCAGGAATGGTGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151500718_1151500725 7 Left 1151500718 17:74486687-74486709 CCCCATTCCCACCATTCCTGCAC No data
Right 1151500725 17:74486717-74486739 TTTTCATGTCACAACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151500718 Original CRISPR GTGCAGGAATGGTGGGAATG GGG (reversed) Intergenic
No off target data available for this crispr