ID: 1151504815

View in Genome Browser
Species Human (GRCh38)
Location 17:74520853-74520875
Sequence GTGGCTATTTAAGGGCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151504811_1151504815 -6 Left 1151504811 17:74520836-74520858 CCGAATCCTCATGGTCTGTGGCT No data
Right 1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG No data
1151504808_1151504815 20 Left 1151504808 17:74520810-74520832 CCATTAAGTGTGAAAATCAGCAT No data
Right 1151504815 17:74520853-74520875 GTGGCTATTTAAGGGCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151504815 Original CRISPR GTGGCTATTTAAGGGCATGA CGG Intergenic
No off target data available for this crispr