ID: 1151507553

View in Genome Browser
Species Human (GRCh38)
Location 17:74539524-74539546
Sequence AGTTCAGCAGTGCCTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507553_1151507558 1 Left 1151507553 17:74539524-74539546 CCCTGGGGAGGCACTGCTGAACT No data
Right 1151507558 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
1151507553_1151507561 21 Left 1151507553 17:74539524-74539546 CCCTGGGGAGGCACTGCTGAACT No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507553_1151507559 5 Left 1151507553 17:74539524-74539546 CCCTGGGGAGGCACTGCTGAACT No data
Right 1151507559 17:74539552-74539574 TGGCTCCTGCTGTCACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507553 Original CRISPR AGTTCAGCAGTGCCTCCCCA GGG (reversed) Intergenic
No off target data available for this crispr