ID: 1151507554

View in Genome Browser
Species Human (GRCh38)
Location 17:74539525-74539547
Sequence GAGTTCAGCAGTGCCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507554_1151507559 4 Left 1151507554 17:74539525-74539547 CCTGGGGAGGCACTGCTGAACTC No data
Right 1151507559 17:74539552-74539574 TGGCTCCTGCTGTCACAGGATGG No data
1151507554_1151507561 20 Left 1151507554 17:74539525-74539547 CCTGGGGAGGCACTGCTGAACTC No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507554_1151507558 0 Left 1151507554 17:74539525-74539547 CCTGGGGAGGCACTGCTGAACTC No data
Right 1151507558 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507554 Original CRISPR GAGTTCAGCAGTGCCTCCCC AGG (reversed) Intergenic
No off target data available for this crispr