ID: 1151507557

View in Genome Browser
Species Human (GRCh38)
Location 17:74539548-74539570
Sequence CCTGTGACAGCAGGAGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507557_1151507565 11 Left 1151507557 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
Right 1151507565 17:74539582-74539604 CTGACCTGGCCTCTGCACACAGG No data
1151507557_1151507561 -3 Left 1151507557 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507557_1151507567 17 Left 1151507557 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
Right 1151507567 17:74539588-74539610 TGGCCTCTGCACACAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507557 Original CRISPR CCTGTGACAGCAGGAGCCAT TGG (reversed) Intergenic
No off target data available for this crispr