ID: 1151507560

View in Genome Browser
Species Human (GRCh38)
Location 17:74539557-74539579
Sequence GGGTGCCATCCTGTGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507560_1151507567 8 Left 1151507560 17:74539557-74539579 CCTGCTGTCACAGGATGGCACCC No data
Right 1151507567 17:74539588-74539610 TGGCCTCTGCACACAGGTCCTGG No data
1151507560_1151507565 2 Left 1151507560 17:74539557-74539579 CCTGCTGTCACAGGATGGCACCC No data
Right 1151507565 17:74539582-74539604 CTGACCTGGCCTCTGCACACAGG No data
1151507560_1151507569 25 Left 1151507560 17:74539557-74539579 CCTGCTGTCACAGGATGGCACCC No data
Right 1151507569 17:74539605-74539627 TCCTGGCAGCCCCTATCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507560 Original CRISPR GGGTGCCATCCTGTGACAGC AGG (reversed) Intergenic
No off target data available for this crispr