ID: 1151507561

View in Genome Browser
Species Human (GRCh38)
Location 17:74539568-74539590
Sequence AGGATGGCACCCACCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507556_1151507561 -2 Left 1151507556 17:74539547-74539569 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507554_1151507561 20 Left 1151507554 17:74539525-74539547 CCTGGGGAGGCACTGCTGAACTC No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507557_1151507561 -3 Left 1151507557 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data
1151507553_1151507561 21 Left 1151507553 17:74539524-74539546 CCCTGGGGAGGCACTGCTGAACT No data
Right 1151507561 17:74539568-74539590 AGGATGGCACCCACCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507561 Original CRISPR AGGATGGCACCCACCTGACC TGG Intergenic
No off target data available for this crispr