ID: 1151507567

View in Genome Browser
Species Human (GRCh38)
Location 17:74539588-74539610
Sequence TGGCCTCTGCACACAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151507556_1151507567 18 Left 1151507556 17:74539547-74539569 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151507567 17:74539588-74539610 TGGCCTCTGCACACAGGTCCTGG No data
1151507557_1151507567 17 Left 1151507557 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG No data
Right 1151507567 17:74539588-74539610 TGGCCTCTGCACACAGGTCCTGG No data
1151507560_1151507567 8 Left 1151507560 17:74539557-74539579 CCTGCTGTCACAGGATGGCACCC No data
Right 1151507567 17:74539588-74539610 TGGCCTCTGCACACAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151507567 Original CRISPR TGGCCTCTGCACACAGGTCC TGG Intergenic
No off target data available for this crispr