ID: 1151509094

View in Genome Browser
Species Human (GRCh38)
Location 17:74547392-74547414
Sequence CTGTGACAGCAGGAGCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151509094_1151509105 18 Left 1151509094 17:74547392-74547414 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151509105 17:74547433-74547455 TGGCCTCTGCACACAGGTCCTGG No data
1151509094_1151509099 -2 Left 1151509094 17:74547392-74547414 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151509099 17:74547413-74547435 AGGATGGCACCCACCTGACCTGG No data
1151509094_1151509103 12 Left 1151509094 17:74547392-74547414 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151509103 17:74547427-74547449 CTGACCTGGCCTCTGCACACAGG No data
1151509094_1151509107 22 Left 1151509094 17:74547392-74547414 CCCAATGGCTCCTGCTGTCACAG No data
Right 1151509107 17:74547437-74547459 CTCTGCACACAGGTCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151509094 Original CRISPR CTGTGACAGCAGGAGCCATT GGG (reversed) Intergenic
No off target data available for this crispr